1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaVladis [17]
3 years ago
14

Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.

Biology
2 answers:
g100num [7]3 years ago
5 0
The toucan's daily diet consists of about four papayas and different kinds of nuts as a supplement to provide for its daily nutritional needs.

Claim: The toucans will not be able to get enough energy from the papaya fruit if they eat the same amount of it.

Evidence: The papaya tree changes solar energy into carbohydrates. This chemical energy, carbohydrates, is eaten by the toucan and converted into glucose for the muscles to use. The muscle fibers contract to convert the said chemical into mechanical energy and heat flow. Thus, this, in turn, becomes kinetic energy to be able for the toucan to fly.

Reasoning: The sun's energy is multi-purpose in nature. Aside from its function as an energy source for photosynthesis to occur, it also aids in the conversion of chemical to mechanical to kinetic energy. However, if a disease has infected the papaya tree population which cause the papaya fruit to produce less stored glucose then this may disrupt the efficacy of the chemical energy drawn from the papaya fruit by the toucan. If this happens, there won't be enough glucose produce to fuel the growth, reproduction and natural physiologic function of the toucan to survive.

Scenario: (If there is a diagram) The diagram shows the natural cycle of energy within an ecosystem between the papaya fruit as the energy source and a toucan. The toucan's daily diet consists of four papayas and a variety of nuts which provides the majority of its nutritional needs. A disease has infected the papaya tree population, causing the papaya fruit to produce less stored glucose.
seraphim [82]3 years ago
3 0

The infected papaya trees will produce less carbohydrates or chemical energy for the toucan. If there were fewer carbohydrates within each papaya, the toucan's muscle cells would not be able to obtain as much chemical energy as they normally do. This chemical energy will be converted into mechanical energy or heat flow, which the toucan uses to fly.

Therefore, the lower amount of mechanical energy and heat flow from the muscle contractions, it would result into a reduced amount of kinetic energy of motion when the toucan is flying.

You might be interested in
What's the different metaphase 1 of mesious and metaphase of mitosis?
katen-ka-za [31]
In Metaphase I<span>, the 'pairs of chromosomes' are arranged on the </span>Metaphase<span> plate while, in the </span>Metaphase II<span>, the 'chromosomes' are arranged on the </span>metaphase<span> plate. In </span>Metaphase I<span>, the spindle fibers get attached to two centromeres of each homologous chromosome.</span>
6 0
3 years ago
Is there a connection between eugenics and techniques of genetic engineering (such as CRISPR )? Where should we draw the line be
dimaraw [331]
Shouldn’t there be a map/picture??
5 0
3 years ago
A,
strojnjashka [21]

Answer:

s

Explanation:

5 0
3 years ago
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0
3 years ago
PLEASE HELP!!!!!      A kangaroo is a mammal. What does a kangaroo lack that mammals such as dogs and cats have? A) amniote eggs
Hitman42 [59]
D because ... they aren't in a placenta
3 0
3 years ago
Read 2 more answers
Other questions:
  • Although all elements comprising a hazard warning label are important, the least important element is the label's _____.
    9·1 answer
  •  Around the globe, cultural factors influence family size and as a result, affect population growth rate. Many of these cultural
    14·1 answer
  • Which two viruses infect all the vertebrates included in the interactive?
    9·1 answer
  • Is it possible today for a eukaryotic cell to live without mitochondria or chloroplasts?
    15·1 answer
  • How the nucleus is organized in eukaryotic cells.
    5·1 answer
  • What are the advantages of having a double helix contain 2 dna strands
    9·1 answer
  • When the insulin molecule is folded where do you find leucine and isoleucine? Where do you find arginine and glutamate?
    15·1 answer
  • How did fossil fuels form, and how are they obtained and uesd?
    6·1 answer
  • Can your body’s vital signs fluctuate (go up &amp; down) and still be healthy?
    8·1 answer
  • A 4-base deletion in the AAUAAA sequence in the 3' untranslated region of an mRNA that eliminates the AAU, thereby preventing RN
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!