1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Triss [41]
3 years ago
12

Describe the production and processing of a protein that that will be exported from a eukaryotic cell.

Biology
1 answer:
12345 [234]3 years ago
8 0
Firts you begin with the separation of the messenger (RNA) from the (DNA) template and end with the release of the protein at the plasma membrane.

You might be interested in
What is an annealing
slega [8]

Explanation:

heat (metal or glass) and allow it to cool slowly, in order to remove internal stresses and toughen it.

OR

recombine (DNA) in the double-stranded form following separation by heat.

6 0
3 years ago
Read 2 more answers
What are the similarities between biosphere and ecosystem
Makovka662 [10]
The difference between them is that an ecosystem is a community of organisms and their environment. And a biosphere is all the living organisms.
6 0
3 years ago
Types of adaptation and explain​
Maslowich

Answer:

The three basic types of adaptations, based on how the genetic changes are expressed, are structural, physiological and behavioral adaptations. Most organisms have combinations of all these types.

Explanation:

Living things are adapted to the habitat they live in. This is because they have special features that help them to survive. The development of these special features is the result of evolution due to gene mutation. These mutations aid in the survival and reproduction and passes on from one generation to the other.

8 0
3 years ago
Read 2 more answers
Where is the sun location in the milkway
victus00 [196]
Our sun is located in the Orion arm, or the Orion spur of the milky way galaxy
6 0
3 years ago
Which of the alternative energy sources do you think would have least impact on the environment explain.
kodGreya [7K]
Wind because the wind does not affect animals as much as water trubines
8 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • How does dna help with the transfer of genetic material from parents to offspring? proteins bind to dna, which activates them an
    12·2 answers
  • The effect that toxins have on a body depends on all of the following except:  A) the concentration of the toxin  B) the amoun
    12·2 answers
  • The amount of energy within a closed system remains constant, energy is not created destroyed A(circuit B( Load C(joule D( law o
    8·1 answer
  • Fungi and bacteria are ___?
    6·1 answer
  • Coral reef ecosystems support over a million different species. please select the best answer from the choices provided t f
    12·2 answers
  • The events in the ovarian and uterine cycles are largely controlled by the pituitary gonadotropins and ovarian hormones. Before
    5·1 answer
  • In fruit flies, red eye color (R) is
    12·1 answer
  • Ano itong paniniwala o pag-iisip na anumang inaasam ng isang tao ay karapatan na dapat bigyan ng dagliang pansin?
    9·1 answer
  • PLEASE HELP 50 POINTS BRAINLIST
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!