1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
3 years ago
10

Do your cells use food to directly power their various functions? Explain your answer.

Biology
2 answers:
jekas [21]3 years ago
6 0
No, they can't. First, the food we eat need to digest to glucose by enzymes. And then the chemical energy of glucose will transfer to energy of ATP or GTP. Then cell will use these to power their various functions. 
ycow [4]3 years ago
3 0

No, they cannot.  

The lipids, proteins, and polysaccharides, which forms the maximum of the food one consume must be dissociated down into smaller molecules before the cells can utilize them, either as a building block for other molecules or as a source of energy.  

Through the process of oxidation, energy is released in the form of ATP. The bonds among the atoms in any molecule accumulate energy and when these bonds are dissociated at the time of metabolism, the energy is taken and accumulated in a molecule known as ATP. This molecule further mediates the functions in the cell that require energy.  


You might be interested in
What are the differences between RNA and DNA​
RoseWind [281]

Answer:

The difference between RNA and DNA is the sugar present in the molecules

Explanation:

In RNA,the sugar molecule present is Ribose while in DNA the sugar molecule present is Deoxyribose.

6 0
3 years ago
give examples of producers consumers and decomposers that could be found along the wild florida wetlands
kvasek [131]

Answer:

hope it helped

Explanation:

producers: Ringed Anemone, Bladderwort, White Water Lily, Spatterdock, Maidencane.

Consumers: Whooping Crane, Blue Heron, Egrets, Florida Panther, Deer, American Alligator, Bullsharks.

decomposers: fungi and bacteria

3 0
3 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
When there are more molecules, there will be less energy.
Natalija [7]
The more molecules move the more kinetic energy they have. I hope that helped
5 0
3 years ago
Read 2 more answers
Which term describes the chromosomal abnormality of having three copies of a single chromosome?
kolezko [41]
The correct answer is a trisomy. Hope this helps.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Scientists evalute if the data fits the hypothesis in this stage of the scientific method:
    12·1 answer
  • What are the long term effects of tsunamis?
    10·2 answers
  • A 2 column by 2 row table. Column 1 is titled Planet with the following entries: A, B. Column 2 is titled Length of a Day in hou
    6·2 answers
  • How can dna be used to help solve a crime
    13·2 answers
  • What is the concentration of sbo at the potential when cd2 will begin to be deposited?
    9·1 answer
  • Researchers studying a small milkweed population note that some plants produce a toxin and other plants do not. They identify th
    10·1 answer
  • Which activity is part of managing water resources?
    10·1 answer
  • 17. Which of the following examples of an ecological effect leading to an evolutionary effect is most correct? A) When seeds are
    11·1 answer
  • How does turgor pressure inside a plant, allow the plant to do? Will give brainliest!
    15·2 answers
  • How can communities limit earthquake damage?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!