1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
professor190 [17]
3 years ago
7

Amphibians can regulate their own temperature. True or False ?

Biology
1 answer:
Ghella [55]3 years ago
6 0
False.

Hope it helps :D

You might be interested in
plzz help me!!!!>>>>>>>>>>>>>>>>>>>>>>>>>>>>
VLD [36.1K]

Answer:

comparative anatomy:

compares the genomes of different organisms

compares the limbs of different organisms

molecular biology:

compares fossilized structures to living organisms

compares cells of organisms

EXPLANATION:

Comparative anatomy is the study of similarities and differences in the anatomy of different species.

Molecular Biology is the field of biology that studies the composition, structure and interactions of cellular molecules – such as nucleic acids and proteins – that carry out the biological processes essential for the cell's functions and maintenance.

HOPE THIS HELP YOU!! ;))))

4 0
3 years ago
Read 2 more answers
Some one help please!! Im timed Will mark Brianlyest
andrezito [222]

Answer:

water table

Explanation:

brainliest pls.

5 0
2 years ago
Read 2 more answers
Can someone please help me
blagie [28]

Answer:

the answer is the H

Explanation:

how do I find them because I read the question it and look at the problem in those blow down and got the answers H or I think it's j

8 0
2 years ago
Read 2 more answers
The process by which modern organisms have descended from ancient organisms is called.
NikAS [45]

Answer:

Evolution

Explanation:

Evolution – change over time. It is the process by which modern organisms have descended from ancient organisms. Current scientific facts, observations and hypotheses all combine to create current evolutionary theory – which is a well-supported, testable explanation of the biological diversity on Earth.

6 0
2 years ago
Changes on Earth’s surface can happen slowly or at a rapid pace. Identify one example of how Earth’s surface changes slowly and
Pavlova-9 [17]

Answer:

An example of a slow change is erosion and an example of rapid change is an earthquake.

6 0
3 years ago
Other questions:
  • What factors do you think determine the age of the universe
    13·1 answer
  • What type of rock forms when preexisting rocks undergo changes in response to a modification of their environment, without first
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is the best evidence that two organism share a common evolutionary ancesery
    5·1 answer
  • Parrafo negativo y positivo
    10·1 answer
  • What will the motion of the box of candy be?
    12·1 answer
  • Where would you expect to find crystals that formed from a solution ?
    9·1 answer
  • You should wash the fruits and vegetables thoroughly before eating. Why?​
    14·2 answers
  • Which describes vestigial structures and how they relate to evolution?
    5·2 answers
  • The biggest difference between elements and molecules is that elements only have one TYPE of atom, while molecules have MULTIPLE
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!