1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
3 years ago
15

Extinction _____.

Biology
2 answers:
snow_tiger [21]3 years ago
7 0

Happens when a species or population dies out

docker41 [41]3 years ago
4 0
D. is your answer for this question 
You might be interested in
WILL GIVE BRAINLIEST!!!!!!!!!
Scrat [10]

Answer: T

Explanation:Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt. Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

3 0
3 years ago
Which hormone is involved in regulating blood sugar levels?
liraira [26]
I think it’s insulin becaus Without insulin, glucose may be present in the blood but the cells are unable to utilize it. People with diabetes lack an adequate supply of insulin
8 0
3 years ago
Which nucleic acid (DNA or RNA) is more important &amp; why?<br>Please help
finlep [7]

Answer:Dna

Explanation:

i don’t know how to explain

3 0
3 years ago
Read 2 more answers
The table shows index fossils.
Gennadij [26K]

Answer:

Paradoxides pinus belong to the life forms that existed during the Cambrian period.

Explanation:

Paradoxides pinus is a form of trilobites that thrived all over the world during the middle of the cambrian period as per index fossils. Structurally, they are found to possess semi circular like head with the cheeks curving into structures that resemble spines. Their eyes are sickle shaped for they are believed to have all round vision. The exoskeleton is large and often flattened or oval in shape with greatest width along the re-curved spine.

5 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Which can support more weight paper or plastic grocery bags?
    8·1 answer
  • What element is found it all organic molecules
    13·1 answer
  • Skeletal muscles are?
    10·2 answers
  • Why do different proteins have their amino acids in different orders
    6·1 answer
  • Which of the following correctly describes the importance of the nitrogen cycle? A to recycle carbon-based compounds
    15·1 answer
  • Identify correct statement from the following
    7·1 answer
  • What other things exist that are too small to be seen without magnification?
    7·1 answer
  • 6. What is the best way to combat the problems created by excessive use of fossil fuels?
    14·1 answer
  • PLSS HURRY Click Natural Selection to read about genetic changes
    10·1 answer
  • The inability of organisms to evolve anything that could be an advantage reflects _____.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!