1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
baherus [9]
3 years ago
15

Do plants grow better with classical music?

Biology
2 answers:
soldi70 [24.7K]3 years ago
8 0
Plant do not grow better with classical music

Ad libitum [116K]3 years ago
4 0
The music does not affect the plant so the plant will grow at the same rate

You might be interested in
Cells, organelles, and tissues are usually measured in __________.
katen-ka-za [31]

The cells, organelles, and the tissues of the body are measured in micrometers. The size of the cells, tissues, and various organelles are very small. Majority needs the help of microscope to be seen. Therefore, the larger units of the metric system cannot be used to measure their sizes. Hence, the smaller unit, such as the micrometer is used for their measurement purpose.

The given blank can be filled with micrometers.

3 0
3 years ago
How do you calculate the eccentricity of an ellips?
Mila [183]
Eccentricity is the ratio of the distance from the center of an ellipse to one of its foci to the distance from the center of the ellipse to one of its vertices. 
4 0
3 years ago
Assessment started: undefined.
Rom4ik [11]
As a result Four haploid cells are produced
8 0
3 years ago
The blending of two traits in which one is not completely dominant over the other is known as
choli [55]
A: Incomplete dominance!

Incomplete dominance is when a dominant allele doesn’t completely mask the effects of the other. The organism, as a result, will show a blending of both.
6 0
3 years ago
A dot is drawn every second to show the position of a toy car coasting up a ramp. Which statement best describes the motion of t
lbvjy [14]

It is speeding up because more distance is covered every second.

Explanation:

The car can be described to be speeding up because more distance is covered every second.

From what we understand about velocity and acceleration, the car is accelerating through the ramp.

It's velocity is increasing with every second it covers.

This will invariable reduce the time between each distance covered.

Originally, the toy car starts with a low initial velocity or speed. As it gains acceleration, the speed will increase and more distance covered per seconds.

This is why the dots clustered towards the end of the diagram. The positions are getting closer and distance reducing per seconds.

Learn more:

Speed brainly.com/question/1548911

#learnwithBrainly

7 0
4 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the most important body system for maintaining homeostasis?
    5·2 answers
  • Help me full in the blank for number 3 please
    5·1 answer
  • Imagine a genetic counselor working with a couple who have just had a child who is suffering from Tay-Sachs disease. Neither par
    15·1 answer
  • Does a flower have a simple or complex structure
    9·2 answers
  • Water (H2O), carbon dioxide (CO2), and oxygen (O2) are all quite small molecules, yet they move across cell membranes differentl
    5·1 answer
  • I need five parasite facts,they help me?please​
    6·2 answers
  • Which organism reproduces through budding?<br> O sponges<br> O bacteria<br> O animals<br> O fungi
    15·1 answer
  • In the context of a scientific experiment, what is a control group?
    7·1 answer
  • Use the key below to report the phenotypes from the provided genotypes.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!