1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
3 years ago
14

Primary targets for insulin action include all of the following except

Biology
1 answer:
Cloud [144]3 years ago
4 0

Answer:

renal glucose reabsorption

Explanation:

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What is the strongest factor that can lead to evolution
zubka84 [21]
There are 4 factors for evolution: mutation, gene flow, genetic drift, and natural selection. Natural selection is the strongest
8 0
3 years ago
What would be a good title for my poster of a cell membrane?
ser-zykov [4K]

A good title would be "The Cell Membrane: _____" and then insert what type of cell it is in the blank.

5 0
3 years ago
During cellular respiration what is the direct source of the energu used in the cells of consumers?
nexus9112 [7]

Answer:

Consumers use chemical energy from the chemical bonds within organic molecules such as carbohydrates, lipids,  and amino acids.

Explanation:

<u>Heterotrophs are consumers</u>; they ingest or absorb organic matter (lipids, carbohydrates, proteins, etc.)  made by autotrophs or producers for their energy consumption. Autotrophs include plants, bacteria, and other photosynthesizing organisms, while heterotrophs include animals, fungi, protists, and bacteria.

Heterotrophs obtain energy from food through the process of cellular respiration. For instance, during aerobic respiration in mitochondria, they break down sugars in the form of glucose into carbon dioxide and water to obtain energy in the form of ATP or adenosine triphosphate.

aerobic respiration:      C6H12O6+ 6 O2 → 6 CO2 + 6 H2O + ≅38 ATP

                                      glucose+ oxygen →  carbon dioxide+ water+ energy

3 0
3 years ago
What difference between heterozygous and homozygous?
marissa [1.9K]
<span>A heterozygous individual is if a mutation occurs in just one copy of the gene.
If both copies of the gene are mutated than the individual is homozygous</span>
4 0
3 years ago
Other questions:
  • 15. A geologist discovers a sample of fine-grained rock made up of very small crystals. Based on its physical appearance, what c
    12·2 answers
  • Plants are used in a variety of industries, such as _____.
    6·1 answer
  • The structure that surrounds the cytoplasm in a bacterial cell is the
    10·1 answer
  • A stimulus type that occurs within the organisms body is
    10·1 answer
  • A sex-linked genetic trait in humans is BEST described by which of the following?
    14·1 answer
  • The term _ describes the enlargement of an organ or tissue because of an abnormal increase in the number of cells in the tissue
    12·1 answer
  • Nitrogen fixation is carried out mainly by...
    6·1 answer
  • Which of these conditions is not among the requirements of the hardy-weinberg equilibrium?
    7·1 answer
  • What bone makes up the lower rim of the eye orbit and the side and bottom of the nose
    5·1 answer
  • Ms. C has recently received a heart transplant. Unfortunately, she is producing large quantities of antibodies against antigens
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!