1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolezko [41]
3 years ago
8

In long term why is it important to reduce demands for timber

Biology
2 answers:
mel-nik [20]3 years ago
3 0
The correct answer is letter C. There will be large shortfalls in timber supplies in the long run, that's why the need to reduce its demand should start now. hopethis helps
iragen [17]3 years ago
3 0
The correct answer is

A.

Lower demand will prevent large increases in timber prices
You might be interested in
Help Please ~ 20 points
max2010maxim [7]

Nitrogen fixation is the process where atmospheric nitrogen is converted by bacteria into biologically usable forms.

plant can not take nitrogen directly from the leaves.

6 0
3 years ago
Read 2 more answers
How many pairs of legs do insects have? five four three
-BARSIC- [3]

Answer:

a spider has 4 pairs of legs, since they have 8 legs

5 0
3 years ago
Photosynthesis can be modeled by its overall chemical reaction. Which two substances are the products, or outputs, of this react
Sunny_sXe [5.5K]

Answer:

glucose and oxygen

Explanation:

6 0
3 years ago
2. If the climate were to change in an environment,
jekas [21]

Answer:

C, there is genetic variation within the population

Explanation:

5 0
3 years ago
In order to prevent pest infestations it is important to.
svlad2 [7]

Answer: Take out the trash regularly, make sure food is stored in secure containers, clean the house regularly, and don't leave perishable foods out for a long time.

8 0
2 years ago
Other questions:
  • In order to move molecules in your kidneys or in your blood your body needs
    8·2 answers
  • Why is the nucleus considered the command center of the celi
    10·2 answers
  • When considering an RBC histogram, what can cause an elevation in the left side of the curve?
    10·1 answer
  • Which of the following stars will live for the longest period of time? A) A huge star B) A medium sized star C) A blackhole D) A
    12·1 answer
  • Which connective tissue protein fibers form a meshlike framework that provides structural support for many organs?
    8·1 answer
  • How many hours of sleep do you really need?
    13·1 answer
  • Three functions of the eye help!!!!!
    13·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Hello, is there anyone here a pharmacy technician?
    10·1 answer
  • Why would very wet soil be dangerous to plants
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!