1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katen-ka-za [31]
3 years ago
10

10 points on the line can u help me on both plz I will appreciate it a lot​

Geography
1 answer:
Nata [24]3 years ago
5 0
I’m not sure, but I think your answers would both be C! I really hope this helps! :) have a blessed day!
You might be interested in
What types of plants & animals evolved after the end Triassic extinction
Zanzabum
It was a quarter of billion years ago and the world nearly came to an end. there was dinosaurs and the greens that they used to eat and today a dino's head is sculptured on a high cliff.
6 0
3 years ago
YA HOOMANS ANWSER
soldi70 [24.7K]

Solution:

The answer is

Resolution:

They knew that once invoked, the executive benefit would shield Bush from investigations.  The Bush Administration invoked executive privileges six times. During each time it had done so, it concerned investigations steaming from the war on terror to meeting with government officials as well requiring members of his team to testify.

3 0
2 years ago
Read 2 more answers
What is the difference between a guyot and a seamount
netineya [11]
<span>Guyots are seamounts that have built above sea level. Erosion by waves destroyed the top of the seamount resulting in a flattened shape. Due to the movement of the ocean floor away from oceanic ridges, the sea floor gradually sinks and the flattened guyots are submerged to become undersea flat-topped peaks.</span>
7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
A closed, "empty' tank containing air at 97 kPa and 22°C survives intact in a fire. If the tank is
DaniilM [7]

Answer:

alot

Explanation:

4 0
3 years ago
Other questions:
  • What does the word "democracy" mean? rule of the gods rule of the people rule by the elite shared rule
    5·1 answer
  • Coal _____.
    14·1 answer
  • Which statement is true?
    11·1 answer
  • If the sea level were to be lowered, which feature of the ocean basin would be most readily visible? A. abyssal plain B. contine
    5·2 answers
  • Will Give Brainliest!
    12·1 answer
  • What are some economic challenges that Cuba is facing? Be sure to discuss at least three examples.
    14·1 answer
  • The sea floor of which of the following oceans has the simplest and most symmetric pattern of age distribution? Group of answer
    12·1 answer
  • Which expressions are equal to 675?
    12·2 answers
  • What Natural disasters ocurr in the texas ecoregions?
    6·1 answer
  • One way to increase nonrenewable resources is through
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!