1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
3 years ago
13

if you are able to eat 10.000.000 bananas at once what would happen to our bodies knowing that bananas contain a small amount of

radiation?
Biology
2 answers:
lubasha [3.4K]3 years ago
6 0
You would die because the radiation levels would disrupt brain waves causing heart failure, stroke, ect.
Pepsi [2]3 years ago
4 0
You would eventually die from the radiation
You might be interested in
What is an example of primary consumer gaining energy?
Usimov [2.4K]
Eating flowers and grass
7 0
3 years ago
Cell membranes contain a central bilayer formed by - A. lipids / B. protein pumps / C. carbohydrates, / D. proteins
mario62 [17]
Cell membranes contain a central bilayer formed by lipids. This protect that membrane.
8 0
3 years ago
For an offspring to ___________ a recessive trait, both parents must have at least one
Crazy boy [7]

For an offspring to dominate a recessive trait, both parents must have at least one dominant allele in their genotype.

8 0
2 years ago
An inference is A. The same as an observation B. A logical interpretation of an observation C. A statement involving numbers D.
Leona [35]
B. Logical interpretation of an observation
4 0
3 years ago
Enzymes can be denatuerd (damaged ) by what environmental factors
tensa zangetsu [6.8K]
Changes in temperature, salt concentration, ionic concentration, of pH levels
8 0
3 years ago
Other questions:
  • The hawaiian islands are the top of an ocean ____
    12·1 answer
  • The splitting of a _____ molecule begins the process of glycolysis.
    8·2 answers
  • Same force on two object of different masses
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • cells contain a specific balance of salt and water. what happens if a cell is dropped into container of pure water
    11·2 answers
  • A beer-making microbiologist noticed that no matter how long the brewing process took, 3% alcohol was the maximum produced. Hypo
    12·1 answer
  • What is the relationship between tissues and organs​
    10·2 answers
  • The document in which elements are organized by their properties<br> is known as the
    8·1 answer
  • 2. Describe the permeability of cell membranes. How to substances cross cellmembranes? Utilize the terms bi-polar, semi-permeabl
    10·1 answer
  • Please provide the complementary DNA sequence, mRNA sequence, tRNA sequence, and amino acid sequence for the following DNA segme
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!