1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
5

Ice floats in water because it _____.

Biology
2 answers:
Nana76 [90]3 years ago
7 0
The answer is B contains more oxygen than water
Shalnov [3]3 years ago
5 0
A. it is less dense.
You might be interested in
How are binary fission and mitosis similar
My name is Ann [436]

Answer:

A

Explanation:

8 0
3 years ago
Which freshwater biome has the highest organism diversity of all the freshwater biomes?
Furkat [3]
Answer: wetlands
Explanation: Wetlands are considered the most biologically diverse of all ecosystems.
3 0
2 years ago
"when drugs and alcohol are mixed this can be fatal"
Marizza181 [45]
If this is a true or false question, the answer is true.
6 0
4 years ago
Read 2 more answers
12. The functions of fat in the body include<br>​
nydimaria [60]

Answer: Triglycerides, cholesterol and other essential fatty acids--the scientific term for fats the body can't make on its own--store energy, insulate us and protect our vital organs. They act as messengers, helping proteins do their jobs

Explanation:

7 0
3 years ago
What is chemistry for
11Alexandr11 [23.1K]

Answer:

chemistry is basically the study of matter and their properties. it also it also explains how and why some substances combine or separate to form different substances.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Functions in excrition
    15·1 answer
  • People who solve a scientific knowledge to solve a practical problems are producing
    9·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is an enzyme?<br> What does "catalyze" mean?<br> What is the "active site"?
    10·1 answer
  • Which adaptation helps polar bears maintain a constant internal temperature (thermal homeostatsis) in cold weather?
    11·1 answer
  • What makes one animal less adapted than another?
    9·1 answer
  • On the way to school, a student rides his bike to the bus
    13·1 answer
  • Asthma is... Question 38 options: a) caused by Myobacterium tuberculosis. b) due to an excessive stimulation of smooth muscle in
    7·1 answer
  • Which enzymes are secreted only by the pancreas
    12·2 answers
  • Which response represents the potential risks of a biohazard exposure to the facial mucous membranes of the eyes, nose, or mouth
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!