1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorC [24]
3 years ago
8

What is the connection between virus prevalence and animal populations?

Biology
1 answer:
ch4aika [34]3 years ago
8 0

Rinderpest disease is caused by a virus that affects hoofed animals, including cattle and wildebeest. In the 1950s, a cattle vaccination program was implemented to eradicate the disease in the Serengeti, and this led to dramatic changes in the populations of wildebeest and other species. The figure shows the number of wildebeest in the Serengeti ecosystem (shaded circles, left y-axis) and the prevalence (i.e., percentage) of individuals infected by rinderpest disease (unshaded squares and triangles, right y-axis) from 1958 to 2003.

You might be interested in
Rank the biomes in terms of how much you expect plant growth to increase as a function of increased co2 in the atmosphere.
Lelechka [254]

The following are the expected ranks of biomes  based on increased oxygen for plant growth and they are

1. Desert,

2. Grassland

3.  Temperate Forest

4. Tropical Rain Forest

The desert biome is formed owing to very limited annual rainfall and it covers approximately 20% of the Earth.  The Grassland is predominantly dominated by grasses while the temperature in the temperate forest is around 10 degree celcius. The plants and trees in this biomes develop special adaptations for their survival. However, the rain forest is characterized with all year round rain hence the biome is moist. The biome is known for vegetations with dense canopies.


3 0
3 years ago
What is innate immunity? Discuss the barriers associated with innate immunity.
Rama09 [41]

Answer:

Innate immunity is a nonspecific defense mechanisms that play its role as soon as an antigen appear in the body (it is relatively rapid but nonspecific and because of that it is not always effective)

Explanation:

The barries of innate immunity are:

Skin: At Epidermal surface, its protective aspect are keratinized cells that lives on the surface, known as Langerhans cells.

Skin sweat or secretions: Their specific defense is sweat glands and sebaceous glands, and their protective aspect is low ph and washing action.

Mucosal surfaces: they are at the mucosal epithelium, and their protect aspects are nonkeratinized epithelial cells.

Oral cavity: They defend salivary glands through Lysozyme

7 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Is a eubacteria a type of eukaryotic explain your answer?
liraira [26]
No it is not as it lacks internal cell membranes.
4 0
3 years ago
The degree in which materials are able to flow freely through a cell's membrane is known as
Slav-nsk [51]
Peremeability ,<span>Water can pass freely through the cell membrane.</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Wapi collected data about four machines and listed it in this table.
    14·2 answers
  • what is a gamete A. a diploid cell that split during meiosis B.the number of chromosomes in a cell C. a haploid cell produced by
    9·1 answer
  • Rigor mortis that occurs in skeletal muscles a few hours after death is due to
    12·1 answer
  • Land plants are divided into two main groups. They are ________________ and _______________.
    14·1 answer
  • ______________is the passing of a wave through an object.
    10·2 answers
  • Which organelle is specific to the plant cell
    9·1 answer
  • Growth hormone and insulin are protein hormones that regulate carbohydrate metabolism by hepatocytes (liver cells) through the a
    15·1 answer
  • A researcher is monitoring a colony of single-celled organisms and notes that the colony is releasing carbon dioxide (CO2) and u
    11·1 answer
  • The appendix, an extension of the large intestine appears, although this is debated, to have little
    15·1 answer
  • Which characteristics make golden eagles successful hunters? (Select all that apply.)
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!