1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uranmaximum [27]
4 years ago
9

8 letter word: living thing that eats other living things

Biology
1 answer:
valina [46]4 years ago
6 0
Omnivore is your answer as i know
You might be interested in
Which of the following statements is correct in regards to the deep ocean circulation of water in the ocean?
Hoochie [10]

Answer:

the answer is C

Explanation: The deep ocean circulation of water is caused by convection currents in water that allow cold water to rise and warm water to sink.

8 0
3 years ago
Why is urine more concentrated in the morning?
Triss [41]
<span>Most people's urine is darker in the morning as the kidneys work hard during the night to remove impurities and the urine is more concentrated.</span>
6 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Pls help.... <br>I will brainliest you if you are good answer. ​
Xelga [282]

Answer:

1. 38.1 cm

2. 8 days

3. 20 blankets

4. 10 cups of detergent

5. 15 dry cloths

Explanation:

1. 15 x 2.54 = 38.1

2. 192/24 = 8

3. 12/3 = 4

   4 x 5 = 20

4. 20/4 = 5

   5 x 2 = 10

5. 10/2 = 5

   5 x 3 = 15

3 0
3 years ago
Which statement best describes how excessive carbon dioxide and other greenhouse gases in the atmosphere alter the system illust
Elanso [62]
They prevent energy of some of the absorbed solar energy from leaving the Earth’s atmosphere
5 0
3 years ago
Other questions:
  • Why do we see different phases of the lunar cycle?
    15·2 answers
  • In a laboratory experiment, C. elegans and B. thuringiensis were cultured individually (control) or together (experimental) for
    10·1 answer
  • Which of these experiments would make use of qualitative data?
    9·2 answers
  • In many cells, the structure that controls the cell's activities is the
    13·1 answer
  • This organelle functions in cellular respiration ?
    9·2 answers
  • How many protons are in Cesium-135 (Cs)?
    7·2 answers
  • Which type of nonvascular plant grows in new or disturbed environments?
    6·1 answer
  • Which kind of investigations never include a hypothesis?
    5·1 answer
  • The process of water moving from the Earth to the atmosphere and back again is called the
    10·2 answers
  • A student is writing a research paper about different bear species. She begins by writing that all bears belong to the class Mam
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!