1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
2 years ago
7

What are the new amino acids formed from this gene? TAG CTT GGC AT

Biology
2 answers:
Vsevolod [243]2 years ago
6 0

Answer:

ATC GAA CCG TA

Explanation:

  • Adenine is paired with Thymine
  • Guanine is paired with Cytosine

so, for every A, T is paired with it

for every C, G us paired with it

sergey [27]2 years ago
3 0

Answer:

The answer is Isoleucine, Glutamate and Proline.

Explanation:

First, the sequence needs to be transformed from DNA to RNAm, so the A's are transformed into U (uracil in RNA) and the G's are transformed into C's (and vice-versa) and the T's into A's. Then, when the RNAm chain is obtained, the first trio turns into (AUC) that codes for Isoleucine, then the second one is (GAA) and it's Glutamate, and finally the third trio codes for Proline (CCG). The fourth part only has two nucleotides so it's impossible to know the amino acid to which it codes.

You might be interested in
The _____ method can help resolve problems logically.
Lina20 [59]
The answer is A.) Theoretic
5 0
3 years ago
Read 2 more answers
What is 1+1+1+1+1+1+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+1+1+1+11+
Lana71 [14]
That would be 564 pls give me brainliest :)
3 0
3 years ago
Read 2 more answers
What are the products of photosynthesis
rewona [7]
They use it to react carbon dioxide<span> with water to make a </span>sugar<span> called </span>glucose. Theglucose<span> is used in respiration, or </span>converted<span> into </span>starch<span> and stored. </span>Oxygen<span> is produced as a by-product. This process is called photosynthesis.</span>
6 0
3 years ago
Read 2 more answers
Pleasehelp me with this study island question!!
galina1969 [7]

Answer:

the third choice

Explanation:

7 0
3 years ago
Read 2 more answers
The virus that causes AIDS, HIV (Human Immunodeficiency Virus), derives from SIV (Simian Immunodeficiency Virus). SIV can only i
sertanlavr [38]

Answer:

Mutation

Explanation:

In genetics, any heritable change of the base-pair sequence of genetic material is referred to as MUTATION.

SIV (Simian Immunodeficiency Virus) must have undergone mutation, which is the basis of genetic variation or evolution

3 0
3 years ago
Read 2 more answers
Other questions:
  • During which process do hapolid cells become diploid?
    6·2 answers
  • The Punnett square for a non-freckled parent and a homozygous freckled parent is shown below. What is the probability that their
    15·2 answers
  • What is that balanced?
    12·1 answer
  • Which organs of the digestive tract lack digestive enzymes?
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which statement accurately describes the relationship between the brain and addiction?
    15·1 answer
  • How do scientific models provide a practical solution for some types of research? Check all that apply.
    11·1 answer
  • If a cell has 18 chromosomes how many chromosomes would each daughter cell have after mitosis
    8·1 answer
  • What order allows animals to get usable fuel from the sun? multiple chose
    14·2 answers
  • Which two organisms most likely have a recent common ancestor? Explain.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!