1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delvig [45]
3 years ago
9

What is the correct formula for magnesium oxide? Mgo2 Mg20 Mgo O Mg202

Biology
1 answer:
monitta3 years ago
3 0

Answer is in image below

You might be interested in
The atmosphere has many functions, such as _____.
BaLLatris [955]

Answer:

Atmosphere refers to the thin blanket of air that surrounds the earth.

It serves many important functions such as:

  • It contains a mixture of gases that are essential for the existence of life on earth. For example, carbon dioxide is essential for photosynthesis and oxygen is essential for cellular respiration.
  • It also serves as the reservoir of water in the form of water vapor. Thus, it forms an important constituent for the water cycle.
  • It maintains the temperature of the earth. Through the greenhouse effect, it maintains the temperature of the earth in limited ranges.
  • It protects the earth from harmful rays of the sun. For example, ozone inhibits the entry of most of the UV rays of the sun into the earth environment.
7 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What is Asynchronous learning?
vlada-n [284]
Asynchronous Learning is when each student works at their own pace, and may not collaborate on work in class meetings, so the correct answer here would be D!
7 0
3 years ago
A bird flies from its nest going north for 2 hours at a speed of
Strike441 [17]
Consider the nest to be (0,0)
The bird first flew 40 km (20x2) up and then 45km (15x3) left
So the final coordinates would be (40, -45)
5 0
3 years ago
Which statement correctly describes the difference between cellular respiration and photosynthesis?
mario62 [17]
Answer: D
explanation: it’s proven that photosynthesis creates the energy for the plant and cellular respiration utilizes it.
hope this helps!
8 0
2 years ago
Other questions:
  • A young man is an avid outdoorsman goes to see his doctor complaining of fever with chills, headache, nausea, and diarrhea. Bloo
    13·2 answers
  • What period of the Mesozoic era did birds first appear?
    8·2 answers
  • Mice eat corn. Hawks eat mice. Which term describes hawks in this food chain?
    14·1 answer
  • How do retroviruses such as hiv differ from other viruses?
    8·1 answer
  • Annika has a friend named pedro how are similar are annikas and pedro DNA
    6·1 answer
  • Which location would benefit best from the use of solar panels?
    12·2 answers
  • Write a sentence with the words: mass extinction, environment, and adapt.
    14·1 answer
  • Why
    9·2 answers
  • Which is the largest bone in the body, found in the hip and groin area?
    9·2 answers
  • Milk
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!