Answer:
Atmosphere refers to the thin blanket of air that surrounds the earth.
It serves many important functions such as:
- It contains a mixture of gases that are essential for the existence of life on earth. For example, carbon dioxide is essential for photosynthesis and oxygen is essential for cellular respiration.
- It also serves as the reservoir of water in the form of water vapor. Thus, it forms an important constituent for the water cycle.
- It maintains the temperature of the earth. Through the greenhouse effect, it maintains the temperature of the earth in limited ranges.
- It protects the earth from harmful rays of the sun. For example, ozone inhibits the entry of most of the UV rays of the sun into the earth environment.
 
        
                    
             
        
        
        
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is 
Explanation:
  1. AACGTACGATCGATGCACATGCATGGCTACGC
 Complementary strand  
      TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
  2. CCCGGGTATGCATGTACGTACGTCGTATATCG
 Complementary strand  
      GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand  
    GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand  
    AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
 
        
             
        
        
        
Asynchronous Learning is when each student works at their own pace, and may not collaborate on work in class meetings, so the correct answer here would be D!
        
             
        
        
        
Consider the nest to be (0,0)
The bird first flew 40 km (20x2) up and then 45km (15x3) left
So the final coordinates would be (40, -45)
        
             
        
        
        
Answer: D
explanation: it’s proven that photosynthesis creates the energy for the plant and cellular respiration utilizes it.
hope this helps!