1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
3 years ago
5

The pedigree chart below shows the inheritance of a sex- linked trait

Biology
1 answer:
noname [10]3 years ago
5 0

Answer:

a

Explanation:

male is x chromosome from father

You might be interested in
When leg muscles respond to a stimulus by moving the foot, the response depends most directly on the functioning of?
pshichka [43]
Nerves - transmit impulse of sensation to brain or spinal cord, then to muscles and organs
7 0
3 years ago
PLEASE HELP ME ASAP!!!!!!!!
Evgen [1.6K]

Answer:

Explanation:

Ureter - carries urine from kidneys to bladder

bladder - storage placer for urine

Nephron - functional unit of kidney

Kidney - filter of waste material from blood

Urethra - exit way of urine from body

6 0
3 years ago
Read 2 more answers
Ronald grows oranges on his farm. He finds that most of the fruit falls off the trees before becoming mature. What should he spr
Kay [80]
<span>
your answer is A

</span>Auxins hormones are used <span>used to </span><span>prevent premature fruit drop, so Ronald should spray the trees with this solution.

On the other hand, abscisic acid stimulated slows the </span>plant growth .


6 0
3 years ago
Read 2 more answers
Which scientist is known for contributions to a scientific discipline that is different from that of the other three scientists?
vodka [1.7K]

Acrhimedes IS YOUR ANWSERRRRRRRRRRR

4 0
3 years ago
If a certain organism is a primary consumer, what best explains its position in the food web? (See picture above)
Ber [7]

Answer:

A. X, because organism X has the same role as the grasshopper

Explanation:

In the food web the organism is denoted by X and it shares the same role as the grasshopper.

A primary consumer is mostly a herbivore. They feed directly on plant matter and convert them into useful nutrition for their own needs.

  • Grasshoppers feed on grasses.
  • They are able to process plant matter into digestible food materials.
  • Organisms of this kind are primary consumers.
  • Organism such as Y are the secondary consumers.
  • They feed on other organism but not directly on the plants.
8 0
3 years ago
Other questions:
  • The ancient remains of plants preserved in the earth in the form of coal, oil, and natural gas are called
    11·1 answer
  • In which ways do humans and animals compete for resources?
    8·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • All chordates share a set of derived characters during at least some part of their life. drag the labels to their correct locati
    8·1 answer
  • Which of the following would be the most appropriate model to
    13·1 answer
  • The movement of substances through the cell membrane without the use of cellular energy
    6·1 answer
  • The ability of trees to transport water hundreds of feet up from the roots is at least partially due to...
    14·1 answer
  • PLEASE HELP
    15·1 answer
  • 11 Matter and energy can neither be created nor
    13·1 answer
  • The portion of the dna double helix requiring the least energy input to form the bond is the.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!