<span>It it C change over time.
go be happy :)
</span>
The water level in the bucket would drop.
This is because the pebbles have a greater density than water - they displace more water (when floating in a cup), than their volume. Thus the water displaced by the cup of floating pebbles has to be more than the volume of pebbles in the cup.
Answer:
30, 000 plaques.
Explanation:
Plaques may be defined as the clear zones or spots that indicates the lysis of the bacteriophages. These plaques are useful to count the number of progeny phages.
The formula used to calculate the phage is as follows;
Plaques progeny = [Number of plaques observe/(Dilution factor x Volume of diluted virus)]
Since, in the given question the dilution factor and volume is not given and it can be taken as unity.
Plaques progeny = 30, 000 / ( 1 x 1)
Plaques progeny = 30, 000.
Thus, the answer is 30, 000.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
