Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The acidity level of water is measured by the pH scale. Pure water has a pH of 7, which is neutral. However, natural rainwater actually has a pH of 5.6 because it gets exposed to the gases in the atmosphere, making it a bit acidic. True acid rain will have a pH level measuring from 5.0-5.5.
Answer:
Firstly, the partial pressure of nitrogen (78%) is crucial to breathing purposes. Without this pressure, the lungs will burst and animals cannot survive.
Secondly, nitrogen is required for the formation of amino acids (building blocks of proteins) and other organic compounds that are necessary for the survival of living organisms. Principally, in the atmosphere, nitrogen is present in the form of molecular nitrogen (N2). N2 is fixed by nitrogen-fixing bacteria that form nitrates and nitrites. These molecules are then used in biochemical processes to produce proteins (amino acids) and other organic compounds. In the absence of nitrogen, these processes could become seize of limited significantly thus affecting life overall.
Thirdly, nitrogen and its derivatives act as greenhouse gases that maintain the Earth's temperature within a range that supports life. Yes, the increased abundance of nitrous oxides is not good because of acid rain and other issues, however, still, the presence of nitrogen is important for life on this planet.
I believe that it consists of about 3 billion letters/base pairs
