Answer:
carbohydrates
Explanation:
Sucrose is a sugar, and sugars are a type of carbohydrate.
Answer:
The correct answer is (b) epinephrine.
Explanation:
Epinephrine, also known as <em>Adrenaline</em>, is a hormone secreted by the medulla of the adrenal glands.
In medicine, epinephrine is used as a stimulant in cardiac arrest, as a vasoconstrictor in shock and as a bronchodilator and antispasmodic in bronchial asthma.
When epinephrine is inhaled in small doses, it causes short-term relief from the symptoms by widening the bronchial tubes allowing air to pass through.
I hope it helps!
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
No.
Explanation:
No, the stone did not take the shape of the glass because stone is not a liquid, it is a solid. Taking the shape of the container in which it is placed is the property of liquid matter whereas the solid maintain its shape and structure when placed in any container. No, the stone did not change the shape and structure when it is placed in the pail due to its solid matter. The properties of matter are the following: It is composed of tightly packed particles which make the matter solid. It maintains its shape and its particles can't move freely like gas and liquid particles.
