1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
2 years ago
12

if a person moved from san diego CA to estes park CO (elevation 7500ft) what would be the effect on cellular respiration for thi

s person?
Biology
1 answer:
bekas [8.4K]2 years ago
8 0

The atmospheric pressure drops so the partial pressure of O2 drops proportionately. The hemoglobin must circulate faster to deliver the same quantity of oxygen to working muscles' mitochondria for cellular respiration. This increased basal circulation rate places a greater demand for oxygen to support it, which triggers in increase in red blood cell population so there is more hemoglobin to deliver O2. With more RBCs the circulation rate once more slows to the old basal rate.

You might be interested in
Enzymes and acidic juices in the stomach, which breaks proteins down into smaller molecules, is known as
djyliett [7]

The answer is; Pepsin


Pepsin is first secreted by the chief cells of the stomach wall and the inactive precursor called pepsinogen. When pepsinogen interacts with the acidic environment of the stomach due to hydrochloric acid, it is turned to pepsin. The pepsin breaks down large protein molecules to smaller molecules.


6 0
2 years ago
The major result of the inflammatory response is to ___________________________.
oksano4ka [1.4K]

The major result of the inflammatory response is to infection or injury. Tissue level , inflammation is characterized by redness , swelling and itching  which result from local immune , vascular and inflammatory cell responses .

Pathogen such as viruses, bacteria or fungi can causes of inflammation. External injuries like scrapes or damage through foreign objects effects of chemicals or radiation.The first and the earliest symptom of inflammation is silent phase which based on reaction of resident cells of the damaged tissue.

There are three main stages of inflammation which can vary from intensity or duration. such as Acute- swelling stage, sub acute- regenerative stage , regenerative stage, chronic- scar tissue maturation and remodeling stage.

To learn more about Pathogen here

brainly.com/question/13051879

#SPJ4

8 0
2 years ago
When (blank) is released from a (blank) neuron and binds with receptors on the motor endplate, the muscle begins to (blank)
777dan777 [17]

Answer:

Explanation:

I think it is: acetylcholine (neurotransmitter) - motor neuron - contract

second question: diffusion because of opening of ca2+ channels

6 0
3 years ago
A power lifter has been advised by his coaches that he needs to lose some weight while still maintaining his rigorous training s
Kruka [31]

Answer:

The correct answer is A. Fat

Explanation:

Fat is one of the macronutrient that is present in our food and fat is accumulated in the body on the liver and in adipose tissue and provide storage form of energy to the body. So fat accumulation contributes to weight gain.  

Fats contributes to more calory per gram than other macronutrient like carbohydrates and proteins, therefore, reducing the amount of fat by taking low calory diet which have less fat amount is important to reduce weight.  

Therefore here to lose some weight by powerlifter fat will likely need to be monitored closely and possibly limited.

6 0
3 years ago
A client is admitted to an acute care facility with complications of celiac disease. which question should be helpful initially
Sindrei [870]
The answer would be: <span>"What is your understanding of celiac disease?"

Celiac disease is one of the allergic/autoimmune diseases that need a good education to prevent recurrence. Before giving information about the disease, the nurse should obtain what information about the disease that they already know.</span>
4 0
2 years ago
Other questions:
  • Unlike gradualism, punctuated equilibrium involves
    12·1 answer
  • True or false? The poles receive 24 hours of sunlight a day during summer, and zero hours of sunlight during the winter.
    10·2 answers
  • What is difficult to determine in the process of adaptation unless there is a closely related species to which you can compare f
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Sienna decides to study movement in plants. Identify the correct sequence of the scientific steps, and place the steps in order.
    11·1 answer
  • What assingment is this and how did we ues it
    13·1 answer
  • Isometric exercise strengthens muscles without __________.A.contracting muscle fibersB.changing muscle lengthC.burning caloriesD
    8·1 answer
  • Pls help question is in picture
    10·2 answers
  • HELP PLEASE THIS IS DUE TODAY.<br> BIOLOGY
    9·1 answer
  • What determines the shape of a protein? How is a protein's<br> shape related to its function?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!