1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
4 years ago
11

Why are raptors a indicator species?

Biology
1 answer:
Arturiano [62]4 years ago
6 0
Indicator species may provide useful substitute for large scale surveys to monitor biodiversity. Weconducted surveys in the Afro-alpine habitats of the Bale Mountains National Park (BMNP) with theobjective of identifying indicators for the species richness of the raptor guild. Raptors were countedby scan sampling technique from a suitable vintage point. Three classes of 18 sample units groupedaccording to the variability of the moorland ecosystem in the magnitude of process variables importantfor raptor species richness were used in determining the indicator value of species as a function of their abundance concentration and the percentage of species occurrence per sample group. Thisprocedure determined indicator values for all species in the resident raptor community. Comparisonwith randomly expected values demonstrated that only<span> Aquila verreauxii</span>and<span> A. chrysaetos</span>haveindicator values that were significantly larger than the randomly expected values. The species richnessestimated using the abundances of these two species predicted the observed species richness of thewhole community in a linear regression model that explained 66% of the deviance in the data set.Furthermore, the species richness of the community predicted by process variables had correlation of very high significance with that predicted by the indicator species. We have thus identified twoindicator species to a raptor guild of the BMNP and demonstrated that these two species encapsulatedmost of the information regarding the species richness response of the guild to key process variablesin the Afro-alpine moorland ecosystem. Our findings contribute significantly to current and futureefforts of monitoring the biodiversity of the park providing a cheap and quick means of data generation<span>relevant for making management decisions.                               Hope this helped! :)</span>
You might be interested in
The enzyme acetylcholinesterase causes acetylcholine to
tatiyna

Answer:

A) decompose.

Explanation:

  • Acetylcholine is a neurotransmitter that acts at the neuromuscular junction and activates the muscles.
  • The neurotransmitter acetylcholine is hydrolyzed by the enzyme acetylcholinesterase into choline and acetate.
  • Due to the activity of acetylcholinesterase, the acetylcholine does not remain for long in the synapses and thus, the synaptic transmission is terminated by the enzyme. 
3 0
3 years ago
Which molecule is correctly paired with the class of molecule to<br> which it belongs?
Kaylis [27]

Answer:

Which molecule is correctly paired with the class of molecule to

which it belongs?

Explanation:

7 0
3 years ago
Pls help! 20 points!!!!!!! Don't just answer for the points!!!
Jobisdone [24]

Answer:

1.a

2.a

3.a

Explanation:

3 0
3 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
According to Mendel, a cross between two round, yellow peas (both with the genotype Rr,Yy) would result in mostly ______________
USPshnik [31]
B!
round Yellow

two round yellow pees together will most likely have round yellow genotypes since that's all they can realistically pass on
5 0
3 years ago
Other questions:
  • which of the following is a limitation of a clinical trial? a. number of test tubes b. hospital costs c. amount of peer review d
    15·1 answer
  • The chemical equation below shows the photosynthesis reaction.
    5·2 answers
  • Sections of our DNA that control what traits we have are called _____________________
    8·2 answers
  • A well designed experimen
    15·1 answer
  • A longitude of a wave is a type of wave that transfers energy ____ to the direction of wave motion?
    8·1 answer
  • State how a deep current forms
    6·1 answer
  • How are lactic acid fermentation and aerobic respiration different?
    11·1 answer
  • A physician has a patient with diabetes. Due to a mutation in the patient’s insulin gene, he does not make the insulin protein.
    14·1 answer
  • What would happen to producer if there was no frogs? answer ASAP!!??​
    7·2 answers
  • Which of the following describes reserch that would be considered applied science ?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!