1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lemur [1.5K]
3 years ago
14

Metabolism is a broad term that includes all chemical reactions that occur within body cells. It includes breaking down substanc

es into simpler building blocks (the process of catabolism), synthesizing more complex cellular structures from simpler substances (anabolism), and using nutrients and oxygen to produce (via cellular respiration) ATP, the energy-rich molecules that power cellular activities. What is false about metabolism?
Biology
1 answer:
Anna11 [10]3 years ago
8 0

Answer:

The statement that is false is <u>metabolism is regulated largely by the nervous system.</u>

Explanation:

The metabolism reactions are controlled by the enzymes specific for each metabolic reactions. After a signal is generated, specific enzymes that detect the signal starts up the metabolic reactions.

When there is a need to stop a certain metabolic reaction, then the mechanism of feedback inhibition is used which stops the enzyme from carrying out any further reactions. Hence, the statement that metabolism is regulated largely by the nervous system is false.

You might be interested in
How many kinds of elements are used in carbon dioxide
katrin [286]

Answer:

2

Explanation:

7 0
3 years ago
Read 2 more answers
Which of the following species is a K-selected species A.redwoodtrees B.fruits flies C.algae D.grasshoppers
NemiM [27]
<span>A. Redwood trees
 K-selected species are living organisms that are usually larger than those in the r-selected species</span>
6 0
3 years ago
Read 2 more answers
Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation
N76 [4]
B is the correct answer
8 0
3 years ago
Read 2 more answers
When an animal confronts a "fight-or-flight" situation, the release of epinephrine promotes glycogen breakdown in the liver, hea
nika2105 [10]

Answer: and Explanation:

A.)The reason for the different products of glycogen breakdown in the two tissues is that glucose 6-phosphotase which is

a known enzyme that brings about hydrolysis of glucose 6-phosphate as a result of the creation of a phosphate group and free glucose is not available in heart and skeletal muscle, therefore,any glucose 6-phosphotase that is produced will just enters the glycolytic pathway and get converted to lactate through pyruvate, in the absence of Oxygen O2.

B) Whenever a situation involving fight or flight arises, the concentration of glycolytic precursors becomes high in order to prepare for muscular activity. Since the membrane is impermeable to any charged species, and at the same time glucose 6-phosphotase enzyme cannot be moved through the glucose transporter, then there cannot be a release of Phosphorylated intermediates from the cell. The blood glucose level must be maintained by the liver by releasing of glucose.

glucose that is later formed from glucose 6-phosphotase then enters the bloodstream.

8 0
3 years ago
Which is the smallest unit of life?
zysi [14]

Answer:

D, cells.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which organ helps to process essential proteins and minerals, so that they can then be taken through the bloodstream and to the
    11·2 answers
  • What is saturns temperature range in the day??
    13·1 answer
  • Last one:
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Some steps in mitosis are shown below. They are not in order.
    14·2 answers
  • Living things get the energy they need from carbohydrates such as glucose. What is the relationship between carbohydrates and AT
    9·1 answer
  • The War of Austrian Succession was known in North America as
    13·1 answer
  • An animals long period of inactivity during winter is called what
    10·1 answer
  • Should scientists who identify genes and create new genetic engineering techniques have the right to patent their methods for th
    8·1 answer
  • How is ATP Synthase powered?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!