1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
9

How do you know that your pregnant? How long does it take to know if you are pregnant

Biology
2 answers:
DochEvi [55]3 years ago
3 0
Well usually it takes a couple of weeks and u have to take a test to find out if ur pregnant
Svetlanka [38]3 years ago
3 0

Answer:

6 days

Explanation:

It takes 6 days then it will show up on a test

You might be interested in
11) AUG (Met) is the codon that begins translation: what is the term for this?
Tom [10]
The answer is Start Codon.
7 0
3 years ago
9. a) How does hydrogen bonding help the transport of water in plants?
grigory [225]

Answer:

Water has a high Cohesion because of Hydrogen bonding. This is important as transport of water in the Xylem in plants relies on water being pulled up. Cohesion also gives the water a high surface tension, allowing small organisms, such as Pond Skaters, to walk along it.

Explanation:

Water molecules forming hydrogen bonds with one another. The partial negative charge on the O of one molecule can form a hydrogen bond with the partial positive charge on the hydrogens of other molecules. Water molecules are also attracted to other polar molecules and to ions.

Plants obtain the hydrogen they need from water molecules. Don't try to feed your plant hydrogen gas -- your plant wouldn't know what to do with it if you did. As long as they have water, plants can readily obtain all the hydrogen they need. :)

6 0
3 years ago
How does mitosis differ from spermatogenesis and oogenesis ?
Snowcat [4.5K]

Answer:

Spermatogenesis:Onespermatocyteproducesfourspermatozoa. Oogenesis:Oneoocyteproducesonlyoneovum. Spermatogenesis:Spermsaresmallerthanspermatocyte. Oogenesis:Ovumislargerthantheoocyte

Explanation:

3 0
3 years ago
What’s amnio acids mean
Andrews [41]

Answer:

Amino acids are organic compounds that combine to form proteins. Amino acids and proteins are the building blocks of life. When proteins are digested or broken down, amino acids are left. The human body uses amino acids to make proteins to help the body: Break down food.

7 0
4 years ago
What happens to the concentration of oestrogen at ovulation?
frez [133]

Answer:

When oestrogen rises to a high enough level it causes a surge in LH from the pituitary which causes ovulation where an egg is released from the follicle (Day 14 of the cycle). The follicle becomes the corpus luteum and this produces oestrogen and progesterone which inhibit FSH and LH production by the pituitary.

Explanation:

5 0
3 years ago
Other questions:
  • What is the relationship between ionic bonds and cleavage
    6·1 answer
  • During the process of_____,a molecule such as glucose must use a protein channel to cross through a cell membrane.
    10·1 answer
  • HELP!!!!!!!!!
    8·2 answers
  • Why is meiosis important for
    6·1 answer
  • Which layer confirms that this sample is soil rather than a mineral mixture?
    12·2 answers
  • How does the procedure for using the microscope differ under high power as opposed to lower power
    6·1 answer
  • Lulu and nana are not transgenic, but they are genetically modified. Explain the difference. Also explain how every cell in thei
    10·1 answer
  • A molecule of ATP contains adenine, ribose, and three phosphate groups. The bond between the last two phosphates is easily broke
    13·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which of the following statements explains why the process of mitosis is essential to life?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!