I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
d (whatever that means):
TACACCCGATGCGCTCGAAGTATGCTAGATCGATGCGTCACCGTCGTCCGTAGTGTAGCTAGCGTAATC
I was also given the codon chart given to convert mRNA into amino acids:
TACACCCGATGCGCTCGAAGTATGCTAGATCGATGCGTCACCGTCGTCCGTAGTGTAGCTAGCGTAATC
I was also given the codon chart given to convert mRNA into amino acids:
1 answer:
You might be interested in
This pertains to the structure of proteins. Secondary structures are stabilized by the presence of hydrogen bonds. The common types of secondary structures of proteins are the alpha helix and the beta sheets, each performing different functions.
Primary structure of protein is the peptide molecule comprised of peptide bonds. Once these peptide grows long enough, it will either be arranged into alpha helices or beta sheets stabilized by hydrogen bonds and this is the secondary structure. Once there is protein folding involved in the secondary structure of protein, then the folded protein is called the tertiary structure (or a protein subunit). When protein subunits come together to perform a specific function, then that is the quaternary structure.
Attached is a figure concerning the protein structures.
Primary structure of protein is the peptide molecule comprised of peptide bonds. Once these peptide grows long enough, it will either be arranged into alpha helices or beta sheets stabilized by hydrogen bonds and this is the secondary structure. Once there is protein folding involved in the secondary structure of protein, then the folded protein is called the tertiary structure (or a protein subunit). When protein subunits come together to perform a specific function, then that is the quaternary structure.
Attached is a figure concerning the protein structures.
