1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
15

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

d (whatever that means):
TACACCCGATGCGCTCGAAGTATGCTAGATCGATGCGTCACCGTCGTCCGTAGTGTAGCTAGCGTAATC

I was also given the codon chart given to convert mRNA into amino acids:

Biology
1 answer:
Anarel [89]3 years ago
4 0
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
You might be interested in
when a chunk of ice left behind by a receding glacier melts , the water stays in the kettle , forming a ?
Juli2301 [7.4K]
The answer is Kettle lake
7 0
3 years ago
What is cybersecurity
Gnom [1K]
Cybersecurity- the state of being protected against the criminal or unauthorized use of electronic data, or the measures taken to achieve this.
8 0
3 years ago
Read 2 more answers
What are unfertilized sex cells called?
vagabundo [1.1K]
The sex cells are called Gametes! Its on Google!
4 0
3 years ago
Explain how modern classification is different from linnaeus methods, and why scientists changed it
SCORPION-xisa [38]

The answer is that the criteria of classification change with the improved understanding of organisms around us. During the time of Aristotle, not much was known about the living organisms. So, he classified them as he observed. Plants were classified into herbs, shrubs and trees; very much like what’s taught to a second grade student. Animals as Enaima and Anaima based on the presence or absence of RBCs. After him, Carolus Linnaeus tried his hand over classification. He came up with the 2 kingdom classification: Plants and Animals. He considered only a set of morphological and physiological criteria to decide the kingdom to which an organism belongs. It includes presence of cell wall, mode of nutrition, contractile vacuole, locomotion and others. Based on these criteria, he included widely differing organisms into a single kingdom, for example, fungi, bacteria, algae, and higher plants were included into plant kingdom just because they have cell wall as a common aspect. Then came, Ernst Haeckel, who came with a third kingdom of Protista to include unicellular organisms. Copeland gave a 4 kingdom classification segregating unicellular organisms into 2 separate kingdoms based on their nuclear structure. R.H. Whittaker came next introducing the most accepted 5 kingdom classification system. You should understand one thing that man’s knowledge of classifying organisms improved with the improving technologies available to him, which he exploited to very effective extent. Carl Woese gave the 6 kingdom classification and 3 domain system based on the 16S rRNA sequence.

Our understanding of organisms around us is improving day by day and the system of classification will also change further in pace with the improvement in technology.

I hope this helps! :D]

~ Kana ^^

8 0
3 years ago
Arrange the following in the correct sequence, from earliest to most recent, in which these plant traits originated. 1. sporophy
zavuch27 [327]

Answer:

Earliest- gametophyte dominance, sporophyte dependence

Middle- sporophyte dominance, gametophyte independence

Recent-  sporophyte dominance, gametophyte dependence

Explanation:

The life cycle of plant alternates between the two phases: the haploid gametophyte which produces gametes and the diploid sporophyte which produces spores.  The evolution of land plants shows how these are dependent on each other in terms of the requirement of nutrition.

In bryophytes, the gametophyte is the dominant phase on which the sporophyte depended. Later in pteridophytes, the sporophyte became dominant which is present in the later evolved groups namely the gymnosperms and the angiosperms. The gametophyte was independent on the sporophyte but in angiosperms and gymnosperms, it is dependent.

3 0
3 years ago
Other questions:
  • Green plants get their energy they need to make food
    7·2 answers
  • what digest and recycle the cell's used components by breaking down proteins, nucleic acids, lipids, and carbohydrates.
    8·1 answer
  • The tubes transporting minerals and water upward are called A epidermis B phloem C cortex D xylem​
    10·1 answer
  • What term describes the form of a gene that produces a specific trait such as eye color?
    9·1 answer
  • Explain two ways helpful bacteria work to keep you healthy
    11·1 answer
  • List TWO of the ethical guidelines regarding professional courtesy among forensic scientists
    6·1 answer
  • How does carbon dioxide enter the atmosphere?
    6·2 answers
  • In humans, MITOSIS directly accomplishes all of the following EXCEPT
    10·1 answer
  • Giving brainliest !!!!!!!!!!!!!!!!!!!!!!!! pls help.
    11·2 answers
  • Help me please <br> Earth and space
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!