1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
15

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

d (whatever that means):
TACACCCGATGCGCTCGAAGTATGCTAGATCGATGCGTCACCGTCGTCCGTAGTGTAGCTAGCGTAATC

I was also given the codon chart given to convert mRNA into amino acids:

Biology
1 answer:
Anarel [89]3 years ago
4 0
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
You might be interested in
Match the level of organization in nature
Volgvan

Answer:

lvl 2 - Molecules consist of atoms

lvl 3 - Cells consist of molecules

lvl 4 - Organisms consist of cells

lvl 5 - Populations consist of organisms

lvl 6 - Communities consist of populations

lvl 7 - Ecosystems consist of communities interacting with their environment

lvl 8 - The biosphere consists of all ecosystems on Earth

Explanation:

4 0
3 years ago
ASAP I NEED ANSWER NOW!!!
SVETLANKA909090 [29]

Answer:

1,431,000,000 kilometers

Explanation:

3 0
3 years ago
Read 2 more answers
Define synapsis. In what stage does it occur?
OLEGan [10]

SYNAPSIS: also called syndesis

the fusion of chromosome pairs at the start of meiosis.

synapsis takes place during prophase I of meiosis.

Hope this helps have a good day.....

7 0
3 years ago
One way that fossils form by the dead organism's soft tissue is ________ by sediments such as sand.
loris [4]
<span>preserved is the answer</span>
8 0
3 years ago
Read 2 more answers
What is the best source of vitamin C?<br> - Cheddar Cheese<br> -strawberries<br> -lentils
seraphim [82]
<span>-strawberries i hope dis helps you</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • How is the cell connected to people
    11·1 answer
  • The dominant generation of lycophytes is the gameotype false or true
    13·1 answer
  • The energy that is used by almost all living things on our planet comes from the sun. it is captured by plants, algae, and some
    7·1 answer
  • Explain how your fluid balance is maintained even when you<br> exerciseand lose fluids by sweating.
    15·1 answer
  • Diseases such as diphtheria result from a process called lysogenic conversion in which viral dna is integrated into a bacterial
    5·1 answer
  • What is the role of the fox?
    6·2 answers
  • The Moon orbits the Earth once in about _______. A. 365 days B. 28 days C. 24 hours D. 7 days
    12·2 answers
  • 5. The process involving the transfer of molten material from one place in the earth's crust to
    10·1 answer
  • What is an important effect of mars low temperature and low air pressure
    13·2 answers
  • Item 3
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!