1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
15

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

d (whatever that means):
TACACCCGATGCGCTCGAAGTATGCTAGATCGATGCGTCACCGTCGTCCGTAGTGTAGCTAGCGTAATC

I was also given the codon chart given to convert mRNA into amino acids:

Biology
1 answer:
Anarel [89]3 years ago
4 0
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
You might be interested in
Which of the following sustainable farming practices allows farmers to rely on their own water supply, rather than bringing in w
Natali [406]

Answer:

drip irrigation I think so

8 0
2 years ago
When students start to feel the accumulating effects of stress, they might look for ways to prevent stress, deal with it, or mas
Otrada [13]

Answer:

Hence, the correct matches are:

A) - 4), 3), 9)

B) - 7) , 5), 10)

C) - 1), 2), 6), 8)

Explanation:

<u>A stressor </u>is a chemical or biological agent, a state of the environment, an external stimulus or an occurrence known to trigger stress to an organism.

<u>Stressor </u>will include 4) breaking up after a long relationship, 9) feeling burdened by academic pressure, and 3) suffering from overly noisy surroundings

<u>Healthy stress management</u> tips are helpful for reducing stress level.

<u>healthy stress management techniques</u> will match 7) practicing yoga a few times per week , 5) watching a sitcom and laughing out loud, preferably with friends , sleeping at least 7 hours per night, and 10) exercising regularly .

<u>detrimental stress management techniques</u> involves activities that harms the human helath and causes stress.

<u>detrimental stress management techniques matches </u>8) using recreational drugs as an escape , 6) going out and binge drinking in order to blow off steam,2)  eating a whole tub of ice cream for comfort , and 1) consuming multiple energy drinks to keep up during all-nighters through finals.

Hence, the correct matches are:

A) - 4), 3), 9),

B) - 7) , 5), 10)

C) - 1), 2), 6), 8)

5 0
3 years ago
2.
puteri [66]
1.25 is closer to 1.04 or not ?
plz heelp plz
5 0
2 years ago
Which of these sources add water to lakes
musickatia [10]

Answer:

what are the sources bff

Explanation:

7 0
3 years ago
Read 2 more answers
Respiration is defined as
finlep [7]

Answer:

It is the action of breathing.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Describe, and account for the different levels of protein structure. How can proteins serve functions that are so diverse?
    8·1 answer
  • Which of the following best describes a heritable adaptation brought about by natural selection?
    10·2 answers
  • When both alleles of a gene are the same, what is the individual?
    13·1 answer
  • Which of the three tests included in McGill’s torso muscular endurance test battery is a timed test involving a static, isometri
    9·2 answers
  • According to the Richer scale, a reading of 2.0 would cause _____ damage, as opposed to a reading of 7.0, which would cause ____
    9·1 answer
  • Why would areolar tissue be considered the ideal type for connective tissue proper? why would areolar tissue be considered the i
    9·1 answer
  • Staphylococcus aureus has become resistant to penicillin, methicillin, and now possibly to vancomycin. Since bacteria do not sex
    11·1 answer
  • How is sound detected by the barin
    13·1 answer
  • Develop an argument as to whether or not the structures and functions of the nervous system work to help prevent injuries. Use e
    9·1 answer
  • A rock with a mass of 10.0kg is balanced on top of a large boulder describe the forces acting on the rock
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!