1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
15

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

d (whatever that means):
TACACCCGATGCGCTCGAAGTATGCTAGATCGATGCGTCACCGTCGTCCGTAGTGTAGCTAGCGTAATC

I was also given the codon chart given to convert mRNA into amino acids:

Biology
1 answer:
Anarel [89]3 years ago
4 0
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
You might be interested in
Removal of a client's peripheral intravenous catheter resulted in brief bleeding and the loss of a small amount of blood. Which
Marta_Voda [28]

Answer:

C)  Release of von Willebrand factor (vWF) from the endothelium, not the epithelium.

Explanation:

Hemostasis is the physiological process of reparation and maintenance of a blood vessel to stop excess loss of blood in case of vascular injury. This process occurs in four stages:

  1. Vascular Injury i.e. a breach in the endothelial barrier. This results in the dislodge of endothelial cells, exposing the collagen fibers underneath.
  2. Vascular constriction or vasoconstriction is the constriction of the blood vessels to prevent excessive blood loss.
  3. Platelet plug formation involves the aggregation and adhesion of platelets to the endothelium.
  4. Coagulation

Platelet plug formation occurs by the adhesion of circulating platelets to the collagen fibers that have been exposed by dislodging of the endothelial cells. The endothelium, as well as the platelets release a ligand known as the von Willebrand factor (vWF). This molecule acts as a relay or bridge between the integrin receptors on the platelets and the exposed collagen fibers.

Platelets also release chemicals to attract more platelets to the wound site, resulting in more vWF release. This results in more and more platelets adhering to the endothelium, leading to platelet plug formation.

6 0
3 years ago
Imagine that plaque uniformly coats the walls of the blood vessel in the diagram. Based on the diagram, what is the reduced area
tatiyna

Hello. You forgot to put the image that complements this question.

The image is attached below:

Answer:

A = 38.465.

Explanation:

To arrive at the result you will have to perform a very simple calculation, using the fromula shown in the question above.

First, it will be necessary to find the diameter of the figure, to

 therefore, you will have to divide, which will result in 3.5.

You can now replace the values in the formula: A = (3.14) (3.5) ² = (3.14) (12.25)= 38.465.

5 0
3 years ago
Compare at least two characteristics of mitochondria to prokaryotic cells and explain how this relates to the endosymbiotic theo
Gekata [30.6K]

The endosymbiotic theory stated that the mitochondria of eukaryotic cells are actually prokaryotic bacteria which were once engulfed by prehistoric eukaryotic cells as a result of evolution.

 

Therefore to answer this question, here are some characteristics: 
1 Both mitochondria and prokaryotic cells contain their own DNA.

2 Neither of the two have true nuclei, but they do have a space in which their DNA is enclosed. 
3 Mitochondria and prokaryotic cells have similar transcriptional machinery, which means that they have the same process of making RNA from DNA.

<span>4 Mitochondria contain their own genome, and the formation of their genome in most organisms is circular similar to prokaryotes.</span>

3 0
3 years ago
What are the viruses two main structures
Yuki888 [10]

1. Protein Coat 2. Nucleic Acid

3 0
4 years ago
What type of cell is a rose thorn
barxatty [35]

rose thorns are multicellular

i hope this helps! :)

3 0
3 years ago
Read 2 more answers
Other questions:
  • Viruses living or non living
    9·1 answer
  • The rn recognizes that in cases of conflict involving client care decisions which principle overrides beneficence
    11·1 answer
  • The science of life is referred to as
    10·1 answer
  • How does the nucleus keep the cell safe?
    12·2 answers
  • What is the disease that destroys the alveoli in your lungs ? thx
    14·2 answers
  • The ________ structure of a protein is created by hydrogen bonds between the hydrogen atom on the amine group and the oxygen ato
    11·1 answer
  • What is the repeating subunit of starch?
    10·1 answer
  • Wind is an uncommon agent of erosion <br><br> A. True <br> B. False
    15·2 answers
  • What does a flow chart look like?
    15·1 answer
  • As DNA ie replicated, which DNA base pair will bond to cytosine ?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!