1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
15

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

d (whatever that means):
TACACCCGATGCGCTCGAAGTATGCTAGATCGATGCGTCACCGTCGTCCGTAGTGTAGCTAGCGTAATC

I was also given the codon chart given to convert mRNA into amino acids:

Biology
1 answer:
Anarel [89]3 years ago
4 0
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
You might be interested in
Alternate forms of a gene that lead to alternative traits are called
Savatey [412]
The answer is alleles.  In addition, the phenotype of an organism is the physical look resulting from the expression of the genes present. The principle of segregation states that substitute alleles for a trait discrete from one another throughout gamete formation and keep on distinct. A diploid organism that has two alike alleles for the same trait is named homozygous for that particular trait.
7 0
3 years ago
Read 2 more answers
How much weight can a male American Pekin duck carry?
vovikov84 [41]

Answer:

up to 13 pounds.

Explanation:

Their fine meat quality and egg-laying ability has made them the first choice of American duck growers. They are the easiest domestic ducks to process and prepare for meat production. Male Pekins carry a Fall weight of up to 13 pounds, and the females weigh about 7 pounds.

8 0
3 years ago
Which of the following examples is an endothermic process? Which of the following examples is an endothermic process? Heat is ne
pychu [463]
<h2>Endothermic Process</h2>

Explanation:

An example of endothermic process is :

Heat is needed for water to boil.

Endothermic process can be defined as a process in which heat energy is absorbed from the surrounding that bring about changes in the molecular level like breaking chemical bonds, inter-molecular force of attraction etc.

Boiling of water is an endothermic process because during this process water absorbs heat , its kinetic energy increases and then it boils.

3 0
3 years ago
What is the name of the selectively permeable outer boundary of the cell, made of lipids and protein. It controls what goes in a
Mazyrski [523]
Cell membrane!!! :v :v
6 0
3 years ago
What is mega biodiversity ?
Musya8 [376]
<span>the variety of life in the world or in a particular habitat or ecosystem.       
examples would be like a group of animals living on a farm or a family in a house.
but if ur meaning "megadiverse"     would be like humans inhabiting the earth.   or the ocean full of marine life</span>
3 0
3 years ago
Other questions:
  • What are the two main groups of sedimentary rocks?
    5·2 answers
  • Evolutionarily, as animals increased in complexity, their nervous tissue began to cluster together. In active animals, the tissu
    15·1 answer
  • mutation that increases the ability to store moisture in a dry environment is harmful beneficial or neutral
    8·1 answer
  • Which organisms capture atmospheric nitrogen for the process of nitrogen fixation?
    9·1 answer
  • What is the relationship between mutation, natural seleection, and adaptation
    5·2 answers
  • What conclusions can be drawn about the existence of carbon-12, carbon-13, and carbon-14? A) These are forms of carbon and they
    5·2 answers
  • Compare and contrast the three kinds of earthquake waves.<br>​
    10·1 answer
  • How we can enhance the protein flexibility for better functioning of protein? What are the effects of protein inflexibility?
    14·1 answer
  • Gene expression can be summarized as
    13·1 answer
  • What element will a low mass star produce over its entire life?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!