1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
5

The fossil record shows that many species remain constant for long periods of time, but then speciation episodes occur rapidly.

This is best described as ___
Biology
1 answer:
Rom4ik [11]3 years ago
4 0

The biological theory describing the rapid events of speciation among many species that remained constant for long periods of time is known as punctuated equilibrium. This theory suggests that many species undergo least amount of change over the time remaining constant and stable until some rare events such as cladogenesis, which causes significant evolutionary changes to occur.

Hence, the correct answer is 'punctuated equilibrium'.

You might be interested in
It is common to use ddNTPs (dideoxynucleoside triphosphates) for sequencing DNA because, when incorporated into a growing DNA po
Aliun [14]

Answer:

B. The ddNTPs lack a 3′ hydroxyl group.

Explanation:

Dideoxynucleotides is a family of inhibitors of the DNA polymerase, its official name is 2',3' dideoxynucleotides but they are commonly called ddNTPs. One of the main characteristics of this compound is the absence of the 3'-hydroxyl group in the deoxyribose, due to the absence of this group, it is impossible to form a phosphodiester bond between nucleotides and the DNA synthesis is stopped.

4 0
3 years ago
Cell theory states that all living things contain one or more cells. Why do you think cell theory meets the definition of
ziro4ka [17]

Answer:

Cell theory meets the definition of a scientific theory  because it can be proven, it has been tested for a long period of time and therefore there are many evidences that support the theory but not enough to become a law. Well scientific laws are statements based on repeated experiments or observation, but also, a law is something that always applies under the same conditions. Evolution occurs in the characteristics of living things within a species overtime. . A theory is much more complex: it explains why something happens. A law only describes what happens.

The cell theory meets the definition of a scientific theory but i do not think it should be a scientific law.

Explanation:

4 0
3 years ago
Please help me to answer this questions. If you help me to answer it I will give you brainiest​
rosijanka [135]

Answer:

A) The Moon Spins Slowly

5 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
(5.01 MC)An estuary ecosystem has been damaged by pollution and sediment runoff. What types of factors should be considered when
andrew-mc [135]

Answer: (D)

Explanation: biotic factors depend among abiotic factors, meaning that living things need non-living things in order to survive. That also means that biotic factors everywhere including the surrounding area need to be thought of in this sense so that they are able to survive in the environment they are in.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Help with my biology homework pls!
    12·1 answer
  • What is the 2n chromosome number for a normal human karyotype?
    6·2 answers
  • Secondary succession occurs when organisms begin to colonize an environment with no soil and no existing organisms. Please selec
    7·1 answer
  • What is the significant role of spore formation in the reproductive cycle of this bacterium?
    6·1 answer
  • Which of these is not true of living cells
    11·1 answer
  • Amolecule of dna was found to contain 120 adenine and 120 guanine bases.how many nucleotides comprise this molecule of dna?
    9·1 answer
  • Stem cells begin to transform into different types of cells in the human body in a process known as cell
    13·2 answers
  • Which compound was abundant in Precambrian Earth’s oceans, before complex life evolved on Earth?
    5·2 answers
  • What are some possible future career fields in environmental science
    11·2 answers
  • Phenylthiocarbamide (PTC), also known as phenylthiourea (PTU), has the unusual property that it either tastes very bitter or is
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!