1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
4vir4ik [10]
2 years ago
13

Jessica is traveling from Chicago, Illinois, to Miami, Florida. Using the map, tell what will happen to the land as she travels

south.
Image of a map, showing a route from Miami, Florida, to Chicago, Illinois. The route goes through the Atlantic Coastal Plain, the Piedmont Plateau, and several mountain ranges.


The elevation will drop below sea level.

The elevation will gradually decrease.

The elevation will gradually increase.

The elevation will remain the same.



I am taking a test, please help ASAP!!!!

Geography
2 answers:
babunello [35]2 years ago
4 0

Answer:

I believe it is C, please correct me if it is incorrect.

Explanation:

Some parts of the route will be mountains, rocky roads, etc. Therefore it will gradually increase.

yarga [219]2 years ago
3 0
The elevation will gradually increase
You might be interested in
Explain how this process shapes Earth's surface Think about: WHY does this process happen? How is ENERGY involved? How is MATTER
GrogVix [38]

Answer:

897898749+4878947948=87798478

Explanation:

if u takee 949484 it turntsinto 38478974894 thanks for the points

7 0
3 years ago
you wake up at 7 am and mom heres your xbox tern on... walk in your room then asks you to takethe dog out....
Triss [41]

Answer:

noooooo it's cold um get em a liter box

7 0
2 years ago
Read 2 more answers
In recent years, the war on drugs has centered on the border between Mexico and the United States. Which of the following statem
maxonik [38]

Answer: A. The amount of violence has been decreasing, so few people have been killed.

Explanation:

The "War on Drugs" does indeed see the U.S. government spending more than $500 million a year as they raid supply chains and arrest traffickers to stem the flow of drugs into the U.S.

Most of the violence does occur near the U.S.-Mexico border as gangs fight to control smuggling routes and U.S. agents attempt to stop them along with police officer, most of whom are dedicated to ending drug smuggling.

The violence however has not been decreasing. Indeed, cartels have become more violent and with the rise of new cartels like the New Jalisco cartel, the violence has spread.

8 0
3 years ago
Read 2 more answers
Which of the following is true about how education and fertility rates are
ollegr [7]

Answer:

C

Explanation:

This is because if you educate a man,you educate an individual and if you educate a woman,you educate a whole nation

7 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
Other questions:
  • This type of economy is more primitive and is based on commonly held beliefs and culture A. Command economy B. Traditional econo
    14·1 answer
  • Urban heat islands can cause an increase in __________ pollution, which is very harmful to people’s health.
    14·2 answers
  • True or False
    7·2 answers
  • Mercantilism is best described by which of the following statements
    8·1 answer
  • The dry area between the pacific ranges and the rocky mountains is called
    8·1 answer
  • __________ are vortices caused by interference to wind by obstruction. They form from the ground upward and are not tornadoes.
    6·1 answer
  • Which religion or religions believes in reincarnation? (select all that apply)
    11·1 answer
  • Which describes the boundary where earthquake activity occurs along rift valleys? divergent boundary in the ocean
    15·1 answer
  • 7. List the four steps of the soil-building process
    6·1 answer
  • Why does the dark half of the moon always face away from the sun?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!