1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnesinka [82]
3 years ago
11

Which adjustment knob do you use first

Biology
2 answers:
yaroslaw [1]3 years ago
6 0
If it's a microscope it should be on the low power setting (10x) and you should only use the course adjustment knob which is the bigger one.
kari74 [83]3 years ago
4 0
The answer above is absolutely correct!
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A marine ecosystem off the California coast consists of leatherback turtles that feed on jellyfish, and killer whales that prey
denis23 [38]
A) a spurt in the number of jellyfish because there will be a decreased number of turtles to feed on them
7 0
3 years ago
Read 2 more answers
The DNA sequence of a gene changed from AACTTG to AACATG. What kind of mutation occurred?
Katena32 [7]
Insertion mutation takes the T out and replaces it with an A. 
7 0
3 years ago
Read 2 more answers
How can you determine the genotype of a plant showing the dominant phenotype?
Gekata [30.6K]
Youwould have to know if the genotype was heterozygous or homozygous dominant
6 0
3 years ago
In the fall of the year, the leaves of some trees change color as chlorophyll begins to break down. What impact does this have o
Rzqust [24]

Answer:

There is no short answer.

Explanation:

The chlorophyll is the pigment that gives the plants' leaves their green colors and it is also responsible for the photosynthesis process which takes place in the mitochondria. In the fall as the leaves change color, the amount of chlorophyll decreases and this impacts the mitochondria as it also decreases the amount of work the mitochondria does.

I hope this answer helps.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why is Ganymede called a moon and not a plamet
    5·1 answer
  • What is the definition of light-dependent reactions and light independent reactions?
    12·1 answer
  • What part of the cell cycle results in the splitting of the new cells?
    6·2 answers
  • Your body makes protein for hair and nails and cell membranes etc. through the process of protein synthesis which includes trans
    15·1 answer
  • Which of the following is NOT true of the plasma membrane?
    15·1 answer
  • List ten importance of conservation of wildlife​
    10·1 answer
  • Allele frequencies for a particular trait are shown over five generations for a population of sexually reproducing organisms.
    15·1 answer
  • Someone please help fill in the blanks​
    10·1 answer
  • Can someone pllllzzz help meee<br><br><br><br> plzz thxxxx
    12·1 answer
  • Which of the following matches a human action with its impact?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!