1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
8

In a classic experiment using pea shape, Mendel conducted two separate genetic crosses. In the first cross the parent plants wer

e “true breeding” for pea shape; one had round peas ( R )and the other had wrinkled (r). The first cross produced a filial 1 generation of all round peas. In the second cross, Mendel bred plants from the filial 1 generation. This cross produced different results. Out of approximately 1000 plants, about 75% were round and 25% were wrinkled.
From these experiments, Mendel developed four hypotheses. They include all BUT
A) one heritable factor may be dominant and mask the other factor.
B) any organism that "shows" a heritable factor must be homozygous.
C) an organism has two "heritable factors", now called genes, one from each parent.
D) a sperm or egg carries only one heritable factor for each trait in the offspring.
Biology
2 answers:
steposvetlana [31]3 years ago
8 0

Answer:

B

Explanation:

Kruka [31]3 years ago
7 0

Answer:

The law of segregation is the Mendel’s laws or principles explain that traits are passed from parents to offspring individually instead of as pairs, groups or sets.This is a law or principle which states that during the formation of gametes, two copies of each heredity factors separate out so that the new offspring can get one factor of both the parents. This law was the first law in this direction. 

You might be interested in
Sickle cell disease is caused by _____ misfolding.
andrew-mc [135]

Answer:

red blood cells (RBCs) misfolding and convert in sickle shapevfrom the donut with out hole shape.

3 0
2 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
HELP ASAP !!!!!!!!!!
Jobisdone [24]

Answer:

the answer would be the first one which is sexual reproduction

8 0
3 years ago
Cells are to tissues as organs are to
Scrat [10]
Organ systems is the answer

4 0
3 years ago
Read 2 more answers
Which of the following statement is NOT TRUE?
kolbaska11 [484]

Answer:

The second one is not true

'(Minerals can be composed of more than one element)'

Explanation:

have a good day/night :)

7 0
2 years ago
Other questions:
  • How might the fatty deposit and the arterial wall affect the nervous system ?
    15·1 answer
  • Could an owl pellet ever be something used to study fossil records? Why or why not?
    6·1 answer
  • Scientists discovered a fossilized cockroach trapped in amber, which was supposed to be about 50 million years old. DNA fingerpr
    9·1 answer
  • Which planet is smallest Mercury Venus or Earth
    14·2 answers
  • How might mutations have allowed for the diversification of plant life on the Hawaiian islands
    14·1 answer
  • DO NOT ANSWER JUST TO GET POINTS!!!!!!!
    7·1 answer
  • (03.03 MC)
    6·2 answers
  • Which of the following best represents the purpose of fertilizers?
    11·1 answer
  • PLEASE HELP!!!!!!!!!
    12·1 answer
  • Which are the following statements are TRUE when concerning cells?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!