1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
murzikaleks [220]
3 years ago
7

The inability of the body to adequately circulate blood and oxygen to the body's cells is known as

Biology
1 answer:
Arada [10]3 years ago
6 0
Circulation of the blood is crucial in the body since it helps in supply of nutrients and oxygen to all parts of the body. It is these nutrients and oxygen that are key in the activities of a cell or a tissue without which the cells wont efficiently carry out their functions.The inability of the body to supply blood and oxygen to the body cells as required is known as hyperfusion. Hyperfusion is caused by inadequate perfusion of the body tissues and thus resulting to inefficient supply of nutrients and oxygen gas to the body cells and tissues.
You might be interested in
How is the structure of endoplasmic reticulum related to its function?
ohaa [14]

Answer:

The endoplasmic reticulum can either be smooth or rough, and in general its function is to produce proteins for the rest of the cell to function. The rough endoplasmic reticulum has on it ribosomes, which are small, round organelles whose function it is to make those proteins.

8 0
3 years ago
Read 2 more answers
Omar studies the effects of a drought on the depth of water in a pond. He takes a reading of the water depth at the same locatio
ValentinkaMS [17]
Line graph is the method he will need to use.
8 0
2 years ago
A student reported that a limp stalk of celery became crisp when placed in ice water In attempting to understand what happened t
FromTheMoon [43]
C. hypothesis. He is giving a possible answer to the question "why did the celery crisp when placed in water?"
4 0
3 years ago
Read 2 more answers
How do earthworms enrich plant growth?
Luba_88 [7]

Answer:

They tunnel through the soil, which allows air to enter.

Explanation:

Earthworms are considered to be agriculturally friendly living organisms that hold immense importance in improving the growth and productivity of plants.

They live in the soil and feed on the debris of plants such as manure, grasses, roots and dead leaves. They extensively channel and tunnel through soils while moving that causes loosening of the soil resulting in more aeration of the soil. The more the soil aeration is, the better soil drainage is.

Studies have shown that soil containing earthworms have ten times better drainage than soils that donot have earthworms. Therefore, C is the best option.


Hope it help!

7 0
3 years ago
What is the function of the stomata in a leaf?
GalinKa [24]

Answer:

it regulates the amount of air or moisture leaving or entering the leave

Explanation:

this is because it has tiny pores which helps in regulating the moisture or heat content leaving or entering the leave

3 0
2 years ago
Other questions:
  • What is it called when you create representations of complex objects or processes
    12·1 answer
  • The two primary jobs of parenchyma cells are _____.
    10·1 answer
  • What is the impact of mutation on current medical treatment
    9·1 answer
  • Which statement best describes cancer cells?
    11·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The bases are paired by ____ bonds along the axis of the molecule?
    8·1 answer
  • The earth is __blank__This trend most closely follows trends in the Earth's __blank__ Within the Earth's __blank__the component
    12·1 answer
  •  What chromosome is a sex-linked trait located on?
    15·1 answer
  • The list shows some of the livestock being raised in South Dakota.
    7·1 answer
  • The activities of the digestive system are regulated by? hormones. intrinsic nerve plexuses.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!