1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
2 years ago
8

Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply.

Biology
1 answer:
Crank2 years ago
6 0

Ans.

Chromatin molecules are made up of DNA and histone proteins. Modification of chromatin structure include covalent, post-translational changes in histone proteins, present in chromation. Acetylation and methylation are two important histone modifications that affect structure of chromatin molecules.

Acetylation involves addition of an acetyl group to histones that increases transcription of DNA by loosen the association between DNA and nucleosome.

Methylation involves addition of a methyl group to histones that results in condensation of chromatin molecule and thus, decreases transcription of DNA.

Both acetylation and methylation are reversible processes.

Many chromatin modifications are genetic, means they can pass from one generation to another generation, called epigenetic modifications.

Thus, options B), C), D), E), and F).

You might be interested in
Urgent Care Centers are extremely busy during cold and flu season. The influenza virus can causes symptoms such as a cough, high
Andrei [34K]

Answer:

-Avoid large crowds

-Wash your hands regularly

-Strengthen your immune system

-Get an annual flu vaccine

-Clean and disinfect surfaces

5 0
3 years ago
What is it important that carbon is recycled?
marshall27 [118]
It's not so important that it be recycled ... after all, there's almost a limitless supply,
and there's no danger of ever running out of it.

What's important is to keep carbon out of the atmosphere.  In order to do that, we
need to reduce the amount of it that's released during so many of the processes
that we've been doing on a huge scale for the past 200 years, and invent ways
to capture the carbon that we DO continue to release, before it gets into the
atmosphere.
6 0
3 years ago
Which group of animal is the closest related to reptiles?
butalik [34]

S: monotremes................................

5 0
2 years ago
How do you think the study of life can help you to understand yourself?<br><br> Some opinions
stich3 [128]

Answer:

I don't think so but u have to find out for your self

7 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Other questions:
  • Different types of cells within an organism ______.
    8·1 answer
  • What are two reasons that a population of herbivores might decline in an ecosystem
    12·1 answer
  • Which freshwater ecosystem is least productive apex?
    9·1 answer
  • What determines the path that an object in projectile motion follows?
    10·1 answer
  • Please Help
    9·1 answer
  • 1. Give an example of mutualism (mutually beneficial relationship) from one of the<br> stations.
    5·1 answer
  • Which organelle converts food into compounds that the cel uses for growth?
    7·1 answer
  • Wind farms are set up to use the energy of wind for the generation of electricity. What is the ecological problem of using wind
    6·2 answers
  • Steel is denser than plastic, yet sound travels faster in steel than in plastic. Develop a hypothesis to explain why. In hypothe
    7·2 answers
  • 13. Jane wants to figure out which of two foods is the healthiest for her pet gerbil, Bob, so she decides to conduct an
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!