Answer:
Resistance in insects develops when the same insecticide (or class of insecticides) is used against a pest population over and over again. Some insects will survive the same dose that kills their friends. Those that survive pass on that survival trait to their offspring.
Explanation:
Hope this helps
Three factors that affect the biodiversity in an ecosystem
include area, diversity of niches, and climate. Keystone species
also have a large effect.
Answer: A Test for Antimicrobial Activity.
Explanation: A Zone of Inhibition test, also called a Kirby-Bauer Test, is a qualitative method used clinically to measure antibiotic resistance and industrially to test the ability of solids and textiles to inhibit microbial growth.
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
Answer:
Explanation:
That's quite a bit of points. Offer 20 next time (which shows up as 10).
Not all experiments lend themselves to this, but the best ones do. Make predictions. The startling experiments (the best of them) certainly allow you to make predictions
Most of the time, experiments confirm what was originally thought. It is, however, the best answer among this bunch.
A is also possible, but not always. I will stick with D, but I think others will pick A.
