Answer:
Feature detection
Explanation:
Feature detection involves different neurons that are activated in response to specific stimuli. For example, feature detectors are activated in the cerebral cortex through visual stimuli of specific shapes or patterns. These neurons become more and more complex as the stimuli also become progressively more complex and specific. Featured detector neurons have been identified in the toad vision, where they have been involved in the toad's behavior in response to worm-like moving stimuli (e.g., orienting), and the bat auditory cortex, where they have been involved in the measurement of the distance between the bat and its prey.
Answer: I think its centriole
C÷C-C-C
1-2-3-4 (left to right)
The ÷ represents the triple bond.
C1 is triple bonded to C2, as well as bonded to a H.
C2 is triple bonded to C1, as well as bonded to C3.
C3 is bonded to 2 H's, as well as C2 and C4.
C4 is bonded to C3, as well as 3 H's.
(Hope this helps, it's difficult to make a diagram on phone).
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer:
100% the dominate trait will show up -- if that is what you are asking about in your question?
Explanation:
