1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zysi [14]
3 years ago
12

Identify and describe the three ways that mutation affect organisms

Biology
2 answers:
Mrrafil [7]3 years ago
8 0

Answer:

they may cause the development of a disease-causing allele

they may cause the development of a more beneficial allele

they in some cases, may have no noticeable affect

Explanation:

aniked [119]3 years ago
3 0

Answer:

Sample Response: Mutations may be beneficial, harmful, or neutral to organisms. If the change caused by a mutation is useful to the organism, then it is beneficial. If the change is damaging to an organism, then it is harmful. If the change is neither useful nor damaging, then the mutation is neutral.

hope this helped

You might be interested in
Which is not a process that has been proposed to explain the formation of precipitation? the atmospheric subduction process the
9966 [12]

the atmospheric subduction process

3 0
4 years ago
Electrical devices that has sound energy as an output
Margaret [11]
<h2>Answer with Explanation </h2>

The speaker and transformer are the devices that consume the electrical energy and release the sound as an output in this process the phenomena which are acquired is electromagnetic induction. The sound energy can also be converted into the electrical energy but fir this process high temperature and high frequency is required. The sound energy is important as it informs us about the character, place and time.

8 0
3 years ago
Succession is possible because
trasher [3.6K]

Answer:

Explanation: you should always believe in your self

3 0
3 years ago
The Lorax tried talking the Once-ler out of chopping down the Truffula trees, until some event occurred. What happened that conv
jeka57 [31]

His business failing was the reason why he was convinced that he was right to chop down the tree.

<h3>What is Chop?</h3>

This is defined as the process in which a substance such as a tree is cut down through the use of tools.

Once-ler business failed and he felt chopping down the Truffula trees will result in him having money through the sales of the resources.

Read more about Lorax here brainly.com/question/7643286

#SPJ1

6 0
2 years ago
Currently, two of the living elephant species (X and Y) are placed in the genus Loxodonta, and a third surviving species (Z) is
Troyanec [42]

Answer:

Explanation:

The evolutionary tree is composed of,

  • Lineages → These are the taxonomic groups of interest placed in the extremes of the lines called branches ⇒ Elephant species X, Y, Z
  • Nodes → These are the ramification points, which are also known as divergence points. They represent the location of the most recent common ancestor ⇒ The red spot in the graph shows the location o the most recent ancestor between species X and Y
  • Root → This is the older common ancestor that all lineages share. The first one in the tree ⇒ The blue spot in the graph show the oldest common ancestor shared by the three species

Two or more lineages are more related to each other if they share a recent common ancestor -In this example, X and Y are more related to each other-. This means that they all diverge from the same node.

Two or more lineages are less related to each other if they lack a recent common ancestor. This is, the node from which these lineages diverge is placed far away in the tree.  

   

6 0
3 years ago
Other questions:
  • The buddhist-majority population of sri lanka is known as the ____________.
    6·1 answer
  • Explique con sus palabras: ¿Qué es la litosfera oceánica y continental?
    8·2 answers
  • Which part of ATP is removed so that energy can be transferred to a reaction or process that needs it?
    7·1 answer
  • The comparison of the actual amount of water vapor in the air to the maximum amount of water vapor the air could hold is called
    15·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • The Milky Way galaxy is described as a disk of stars orbiting a central
    15·2 answers
  • Which of the following is a function of stomata?
    9·1 answer
  • All organisms need A.to live near water B. a source of energy or C.to live in a group with other organisms
    6·1 answer
  • Are individuals with a variation of this trait more successful at reproducing than others?
    5·1 answer
  • How do good and bad ozone form? (Site 1)
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!