1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
3 years ago
5

Which of the following are commonly shown on a geologic map ?

Biology
2 answers:
hjlf3 years ago
5 0
D. scale and legand.
7nadin3 [17]3 years ago
4 0
Scale and legend is usually on most maps, so it could be that but I think its B
You might be interested in
The wastes of excretion are in the form of ________ and ________​
nlexa [21]

Answer:

Solid e.g faeces

Liquid e.g Urine

3 0
3 years ago
Oncogenic viruses Oncogenic viruses are genetically unstable. have no effect on the host cell. are lytic viruses that kill the h
aleksandrvk [35]

Answer:

cause tumors to develop.

Explanation:

Oncogenic viruses are viruses that do not kill or lyses the cells of the host outright but has the capacity to cause to cause a long term infections that may eventually lead to the formation of tumor or cancerous cells within the body of their hosts.

<em>Hence, the fourth option is the correct option. That is, they cause tumors to develop</em>

5 0
3 years ago
Which isn’t an example of a matrix in which organisms may become fossilized
Damm [24]

Answer:

where's the options for this question?

6 0
3 years ago
Carbon is rare in that it does NOT bond with any other elements.
sveta [45]

Answer:

False

Explanation:

-Carbon has 4 electrons in its outer shell

-It can achieve a full outer shell by forming Covalent Bonds

7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • Which process changes the water vapor into water droplets that form the cloud?
    6·2 answers
  • What information can be gleaned from a hypothesis that was not supported
    8·2 answers
  • The general formula for a synthesis reaction is what
    10·1 answer
  • What is the purpose of the vas deferens?
    8·2 answers
  • How should the biological name of the giant water bug be written in binomial nomenclature?
    13·1 answer
  • At what angle relative to the velocity of a red blood cell should the transducer be held during Doppler ultrasound to most accur
    8·1 answer
  • Which of these is NOT true. Once the Human Genome was completely mapped, scientists found
    7·1 answer
  • Why is it necessary to eliminate absolutely all invasive fire ant colonies to eradicate the invasive population?
    11·1 answer
  • Light material floated up and became the early mantle and crust while iron and nickel pulled to the center of Earth. Which answe
    15·1 answer
  • Ymerereel kslaf unscramble
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!