1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew11 [14]
3 years ago
8

What is the outcome when a cell undergoes meiosis

Biology
2 answers:
Zinaida [17]3 years ago
8 0

When a cell undergoes meiosis,the outcome of the process is FOUR HAPLOID CELLS.

Meiosis refers to a form of cell division which always results in the formation of four daughter cells. The four daughters cells produce have diploid cells which contains half the original of chromosomes from the parents. A diploid cell has two of each chromosome, one from each parent. The eggs and the sperms that are involved in reproduction possess haploid cells. In meiosis, the whole process start with diploid cells which divide twice to produce four haploid cells


Read more on Brainly.com - brainly.com/question/1596729#readmore

AVprozaik [17]3 years ago
3 0
In meiosis, however, you start with a diploid cell that divides twice to produce four haploid cells.

You might be interested in
Match the words from the list with the correct statements.
Brrunno [24]
1-


2-


3-


4-


5-


6-


7-
A- embryo

8-
A- egg cell

9-
A- sperm cell

10-
4 0
3 years ago
Cross a mother who carries the hemophilia gene but does not express it, With a father with hemophilia
alisha [4.7K]

Answer: The cross will produce 4 offsprings with the following genotypes:

XhXh, XhX, XhY and XY.

Explanation: Hemophilia is an X-linked disease. A woman who carries the hemophilia gene but doesn't not express it is heterozygous, therefore she has a genotype of XhX, and a man who has hemophilia has a genotype of XhY. A cross between them will produce one female and one male who are hemophilic (XhXh and XhY), one female who is a carrier (XhX) and one normal male.

See the punnett square attached for the cross

3 0
3 years ago
What did you know about Nerves? Explain the types of Nerves.​
S_A_V [24]
The nervous system controls everything you do, including breathing, walking, thinking, and feeling. This system is made up of your brain, spinal cord, and all the nerves of your body. The brain is the control center and the spinal cord is the major highway to and from the brain.
4 0
3 years ago
Read 2 more answers
Who developed the principle of Biological Succession?
Whitepunk [10]
Charles Darwin James
4 0
3 years ago
) what basic principles of antibody-mediated immunity are utilized in an elisa assay
Komok [63]
<span>The most crucial principle of ELISA (enzyme-linked immunosorbent assay) is a highly specific antibody-antigen interaction.</span>
ELISA is a biochemical technique used to detect the presence of an antibody or an antigen in the biological sample. Simply described, in an ELISA, an antigen is immobilized on a solid surface and then a specific antibody is applied over the surface so that it can bind to the antigen. The antibody is usually linked to an enzyme, and in the final step, a substrate for that enzyme is added. The enzyme can convert it to some detectable signal, most commonly a color change. <span>Medical usage of ELISA is in the diagnosis of HIV infection, pregnancy tests, measurement of cytokines…</span>
3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A balance between gravity pulling atoms toward the center and gas pressure pushing heat and light away from the center is called
    13·1 answer
  • What is agriculture ​
    9·1 answer
  • Chemical weathering has little effect on: <br> mica <br> feldspar <br> quartz <br> basalt
    9·2 answers
  • An agency that is heavily involved in combating medicare and medicaid fraud is ____
    5·1 answer
  • What function do chloroplasts perform
    10·2 answers
  • Measuring the height of a plant is an example of _____ data
    10·1 answer
  • Which organisms produce about half of the ox gen on Earth?
    12·1 answer
  • How can you make it safer to exercise on a hot day?
    7·1 answer
  • Which of the following lists BEST describes increasing levels of organization of the genetic material in living organisms?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!