Answer:
In a lot of ways for example finding how large or small a part of a map is.
Explanation:
Answer:
True, majority of the earth energy source comes from the <u>internal motion</u> but rest comes from outside.
Explanation:
- Earth gets its energy from the interior of the planet like the core which forms the most essential driving force of the planet it not just only regulate the flow of geomaterial from the bottom to the top but also acts as a geothermal source for various energy process.
- As we know this is called the Endogenetic force of the planet caused due to the earth rotation without which earth would have been dead long ago. The external forces of Denudation which break down the landscape from above are of Exogenic in nature.
- The sun's rays that are 100% at the surface of the earth but, come down o only 50% at the ground level as most of it gets deflected by the natural Albedo of the earth with is 35%. This partial absorption, deflection, and then reflection
- Thus this process is a temporary phase as all this gets reradiated back in a long wave from at night.
- Thus internal thermodynamics has a huge role to play in the formation of earth energy processes.
Answer : True
Hope this helps.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
The illegal migration has created socio-political and economic problems and lead to the growth of population in the southern states.
Explanation:
- Most of the migrants include individuals from north Africa and sub-Saharan regions that have migrated to the southern states of Europe like Spain and Italy. Many have come from Morocco, Algeria Tunisia, and other places.
- They have affected the population diversity of the country and permanently settled in France, Netherlands, Spain, Germany, and Belgium. Since 2000 illegal migrations have resulted in rising of conflict and poverty.
- Some positive effects of migration include the education and job aspects while the negative impacts can be seen as the growth of slums and asylums and child laborers. Their impact on resource usage and economic development has changed in many European cities.
