1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vampirchik [111]
3 years ago
8

What benefit do nitrogen-fixing organisms provide in an ecosystem?

Biology
1 answer:
bazaltina [42]3 years ago
4 0
Nitrogen-fixing bacteria are microorganisms present in the soil Or in plant roots that change nitrogen gases from the atmosphere into the solid nitrogen compounds that plants can in the soil
You might be interested in
when we observe an organism or environment what are we observing A. changes B. similarities C. colors​
salantis [7]

Answer:

II really have no idea but it might be A?

Explanation:

If I'm wrong I'm so sry T-T

6 0
3 years ago
During aerobic cellular respiration, what combines with hydrogen ions and the product is released as a by-product of respiration
Rufina [12.5K]
 The correct answer is C, Oxygen.
During aerobic cellular respiration, oxygen combines with hydrogen ions and water is released as a by-product of respiration. 

Explanation; 
Cellular respiration allows organisms to release energy stored in chemical bonds of glucose, and other nutrients. The energy in glucose or other nutrients such as fats is used to produce ATP, which cells use to supply their energy needs. During aerobic respiration (in presence of oxygen), oxygen is reduced and water is produced together with carbon dioxide as by-products. 
8 0
3 years ago
Read 2 more answers
EASY 28 POINTS<br><br> tolerance what does it mean to u why it it important own word plssss
stiv31 [10]

Answer:

tolerance is the willingess to accept, and see value in the views of others

6 0
2 years ago
Provide one evolutionary explanation for why lizards living in the same habitat i.e. grass would have similar characteristics
kupik [55]
I don't know the options, but if more then one lizards live in grass and have similar characteristics then I do believe it would "Adaptation" since they are adapting to live in that environment... my apologies if I am incorrect
Hope this helps!!!!
8 0
3 years ago
Samantha’s job involves studying ecosystems and their components. Specifically, she deals with the population and growth of the
abruzzese [7]
The appropriate response is population ecologist, it is the investigation of these and different inquiries regarding what components influence populace and how and why a populace changes after some time. Populace environment has its most profound recorded roots, and its wealthiest improvement, in the investigation of populace development, control, and flow, or demography. While Entomologist studies insects and a conservationist acts to protect and preserve the environment/wildlife
7 0
2 years ago
Other questions:
  • Changes in hemoglobins's oxygen affinity are primarily the result of changes in the _____________ structure of the protein.
    5·1 answer
  • What kinds of molecules pass using transport proteins
    5·2 answers
  • What is the difference between self-love and selfishness according to Aristotle?
    13·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Hey y'all I just really need help with this question so if y'all didn't mind and try to help me that would be greatHELP ME PLEAS
    9·2 answers
  • Use an analogy to explain the function of the nucleus, cell membrane, mitochondria, and ribosomes
    6·1 answer
  • Which would most likely form a homogenous mixture?
    13·2 answers
  • Please help and explain the answer
    15·1 answer
  • Which solution is hypertonic?
    11·2 answers
  • What is the possible plan of action? (About landslide reasearch)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!