1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DiKsa [7]
4 years ago
7

Which of the following explains the inversion of the aquatic pyramid of biomass? a. high phytoplankton turnover rate b. slow aqu

atic predator metabolisms c. small number of aquatic consumers d. high energy content of phytoplankton
Biology
2 answers:
mixas84 [53]4 years ago
6 0
C is the correct answer I believe.
viktelen [127]4 years ago
6 0

Answer: Option C

Explanation:

The number of consumers is less than the number of producers but the biomass of consumers is more than the biomass of the producers.

The pyramid of the aquatic biomass is inverted it is because the size of the consumers is large as compared to that of the producers.

The consumers such as the fishes and other aquatic animals have more biomass as compared to that of the phytoplanktons.

You might be interested in
What are some examples of how the digestive system maintains homeostasis?
LenKa [72]
The helpful bacteria and The pH balance
6 0
3 years ago
Not considered part of the cell cycle
Sedbober [7]

Answer: what isnt?

Explanation:

6 0
3 years ago
WHAT SHOULD U DO AFTER MAKING A HYPOTHESIS
Illusion [34]
You should test your hypothesis.
8 0
3 years ago
Read 2 more answers
2. The nucleus of an atom contains
8_murik_8 [283]
Choice 1 protons and neutrons, not electrons because they are in the outside circling it
3 0
3 years ago
Which of the following are characteristics of organisms in the Kingdom Plantae? *
GaryK [48]
Kingdom Plantae includes all the plants on the earth. They are multicellular, eukaryotes and consist of a rigid structure that surrounds the cell membrane called the cell wall. Plants also have a green coloured pigment called chlorophyll that is quite important for photosynthesis.
8 0
3 years ago
Other questions:
  • True or False: Moderna shared that their initial vaccine trials showed that people injected with the vaccine made as many or mor
    12·1 answer
  • ANSWER I WILL MAKE YOU THE BRAINLIEST Organisms can reproduce sexually or asexually. There are important differences between the
    8·2 answers
  • What is the pigment that is necessary for photosynthesis to occur?
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Frank is doing an experiment to find out how the amount of oxygen dissolved in water affects the growth of algae in a body of wa
    13·2 answers
  • The binding of Ach to its muscuranic receptors indirectly affects the permeability of _____ channels which can produce hyperpola
    7·1 answer
  • The most crucial factor determining the resting potential of a neuron is the diffusion of
    14·1 answer
  • The population of deer in Grand Canyon National Park increased from 4,000 to 65,000 between 1905 and 1920. This increase in deer
    9·1 answer
  • A population of hummingbirds feeds exclusively on nectar from orchids. Two species of orchids exist in the hummingbirds' habitat
    15·1 answer
  • [ planet and the sun?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!