1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
2 years ago
12

What component of Earth’s atmosphere exists entirely as a result of photosynthesis?

Biology
2 answers:
Gennadij [26K]2 years ago
7 0

Answer:

oxygen gas

Explanation:

during the process of photosynthesis in plants the final product is oxygen gas

Naddika [18.5K]2 years ago
5 0

Answer: Oxygen

Explanation: Oxygen is primarily produced by photosynthesis.

You might be interested in
Science uses data to describe the findings of an experiment. Qualitative Data is:
kirill [66]

Scientific data refers to the information collected by using the scientific method. These data can be obtained from experimental and/or observational procedures.

  • There are two types of data: qualitative data and quantitative data.

  • Qualitative Data is a set of data describing the findings of an experiment (Option B).

  • On the other hand, quantitative data refers to the set of measurements/numbers collected in an experimental or observational procedure.

Learn more in:

brainly.com/question/17216882?referrer=searchResults

6 0
2 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
11. Punnett squares can also be used to predict genotypes of the parents. A guinea pig with short hair is crossed
emmainna [20.7K]

Answer:

Ss × ss

Explanation:

This question involves a single gene coding for hair length in guinea pigs. The alleles for short hair (S) is dominant over that of long hair (s).

According to this question, a guinea pig with short hair (S_) is crossed to one that has long hair (ss) to produce offsprings that have 44 short hair and 46 long hair. This number of offsprings produced indicate a ratio of 1:1, which can only be produced if the short haired guinea pig is heterozygous i.e. Ss.

Therefore, the genotype of the parents are Ss (short hair) and ss (long hair) i.e. Ss × ss. This combination will produce offsprings with the following proportion: Ss (1) : ss (1).

4 0
3 years ago
A unique feature of muscle tissue is that it is capable of
kogti [31]

Answer:

Contraction.

Explanation:

Muscle tissues are defined as they are elastic and extensible in nature. In other words it's also defined as they are able to stretched and returned to its original size and shapes. A unique feature of muscle tissue is they are able of contractile in nature. With the help of this contraction they are able to sliding myosin and actin filaments which are present in muscles tissues.

Basically muscle tissues are three types:

1) Skeletal muscle: They are strong and rapid in contraction.

2) Cardiac muscle: They are strong in contraction.

3) Smooth muscle tissues: They are slow and weak in contraction.

4 0
3 years ago
Class Mammalia is divided into two subgroups: marsupials and placental mammals.
White raven [17]

Answer:

The given statement is false.

Explanation:

The mammals can be differentiated into three main groups on the basis of the development of their babies. These three groups are marsupials, monotremes, and placental mammals, which is the largest group. The monotremes refer to the mammals, which lay eggs. The marsupials refer to the mammals, which give birth to young ones that are not developed completely. While in a placental mammal, the development takes place within the body of a mother until and unless its systems of the body start to work on their own.

3 0
3 years ago
Other questions:
  • Living microorganisms found in soils and waters are generally capable of growth on common laboratory media. select one:
    6·1 answer
  • The body is composed of microscopic cells that are only visible if viewed under a
    14·2 answers
  • Atom in a blank stay in a fixed position and have no freedom to move
    5·1 answer
  • Which describes the number of new infants per one thousand individuals in a
    8·1 answer
  • Which part of the peripheral nervous system is most important in helping you to walk?
    7·2 answers
  • Why can the deletion of a single nitrogen base in DNA due to a mutation be harmful to an organism?
    7·1 answer
  • mitosis A division happens in the next step. Which describes the cells after the next step is complete? A. The cells will have n
    13·1 answer
  • What structure acts like the our skin monitoring what goes in and out of every single cell?
    10·1 answer
  • (6th grade science) Why do temperatures on Earth Increased when the amount of carbon dioxide?​
    7·2 answers
  • Which sport below requires the least cardiovascular fitness?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!