1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorC [24]
3 years ago
11

You are a Botanist who had just discovered a new plant species. As every good scientist does, you will document your exciting fi

nding. Design a fact sheet highlighting this new plant discovery. Be sure to include the following key pieces of information.
 Your plant’s name.
 Your plant’s basic needs.
 How your plant’s needs are met.
 Where your plant lives?



I will mark the brainliest for the 1st and best answer!
Biology
1 answer:
Rudik [331]3 years ago
4 0

Explanation:

my plan to be a cactus a plant basilica be sunlight and water with his basic fit my parents needs are met because every morning I will use for issaquah we'll go to the beach I will go to wait till you can feel it when my plant leaves will be somewhere I supposed to like not much heat but the heat is ok

You might be interested in
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
3 years ago
Which characteristics are necessary for a society to be considered a civilization?
jek_recluse [69]

Answer:

The six most important characteristics of a civilization are cities, government, religion, social structure, writing, and arts and architecture.

Explanation:

7 0
3 years ago
Read 2 more answers
PLEASE HELP! what are environmental parameters that should be examined before building on land?
Serhud [2]
I would say that you would need to see what the environment around the area is. and what kinds of animals would be out of homes.<span />
5 0
3 years ago
Which practice is used to destroy and eliminate<br> all threats in the microbial world?
hichkok12 [17]
Sterilization controls the microbial in this world
5 0
3 years ago
What signals the ribosome to start translation?
Lisa [10]
C. A start codon sequence
5 0
2 years ago
Other questions:
  • Which of the following can be determined through the examination of fossils?
    9·1 answer
  • Which term refers to the behavior of two species attempting to use the same living space food source and water source?
    8·1 answer
  • Please answer these questions I need help this is my second attempt cause I failed the first one please help me
    14·1 answer
  • What is the probability of producing a tall pea plant from a genetic cross between two hybrid tall pea plants?
    12·1 answer
  • This is the normal nucleotide sequence on a dna strand: A-C-T-G-G-A-T what is a substitution?
    9·2 answers
  • Can someone find these answers for me?
    9·1 answer
  • How does using killed or weakened bacteria in an immunization help the body prevent infections?
    8·1 answer
  • What are the basic steps of scientific method? (specifically, I think there are 5 specific steps)
    8·2 answers
  • Name 3 Native American groups who sided with the French
    12·1 answer
  • How do we link monomers to make polymers
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!