1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
8

What are the basic steps of scientific method? (specifically, I think there are 5 specific steps)

Biology
2 answers:
bija089 [108]3 years ago
8 0
1- observation
2-hypothesis
3-test hypothesis
4-analyze data
5-conclusion
FrozenT [24]3 years ago
7 0

Answer:

Make an observation.

Ask a question.

Form a hypothesis, or testable explanation

Make a prediction based on the hypothesis

Test the prediction.

Use the results to see if you were right or wrong

You might be interested in
In what part of the day do plants produce more carbon dioxide than oxygen?
AveGali [126]

Answer: The night

Explanation:

Remember that a plant does two things, it either produces energy by photosynthesis, in which case it takes up the carbon dioxide and releases oxygen, or consumes energy to grow/carry out the functions of life.

In the second case, the plant takes the glucose, or sugar, that it made during photosynthesis and breaks it into pieces, releasing energy. This step is accompanied by the release of carbon dioxide into the atmosphere. This happens all the time, but since the plant does not produce sugar and release oxygen during the night, the night is when it produces more CO2 than O2.

8 0
3 years ago
Select the correct answer,
Vlad1618 [11]

Answer:

A

Explanation:

insulin is released from pancreas when blood sugar level rises

3 0
3 years ago
Read 2 more answers
When new habitat is made available, organisms can diversify rapidly. this can be gradual or punctuated. what is this process cal
Shalnov [3]

When new habitat is made available, organisms can diversify rapidly. this can be gradual or punctuated this process called as adaptive radiation.

<h3>What is Habitat?</h3>

The term "habitat" in ecology refers to the variety of resources, physical characteristics, and biotic elements that exist in a region and are necessary for a specific species to survive and reproduce. An animal's habitat can be thought of as the outward representation of its biological niche.

Thus, the term "habitat" refers to a specific species and is fundamentally distinct from ideas like the environment or vegetation assemblages, which are better described by the term "habitat-type." 

The physical elements could consist of things like soil, moisture, temperature range, and light intensity, for instance. The availability of food and the existence or absence of predators are examples of biotic variables. Every species has certain habitat needs; habitat generalist species can survive in a variety of environmental circumstances, whereas habitat specialist species need a specific habitat.

Learn more about Habitat with the help of the given link:

brainly.com/question/929351

#SPJ4



3 0
2 years ago
A radioactive element has a half-life of 1000 years. A rock contains 6.25% radioactive material. How old is the rock?
Natali5045456 [20]

ANSWER:

Radioactive element life years = 1000/2 = 500yrs.

So, Rock years

  • 6.25/100 × 500
  • 31.25years.
7 0
3 years ago
The light-dependent reactions include an electron transport chain system that works in a very
mamaluj [8]

Explanation:

When the high energy electrons move from the reactive center, they are conveyed from one chain protein to another as the energy in the electrons is harnessed to pump H+ ions from the stroma into the lamellae. The electron will ultimately reduce NADP+ to NADPH and the electrons in the reactive center will be replaced by high energy electrons from the splitting of a water molecule in photolysis. The energy of the sun is used to split the water molecule. The high energy electrons then undergo the same cycle as the previous electrons and the cycle continues.

Eventually a proton-motive force is created across the lamellae membrane. This potential energy of the high H+ ion gradient is used by ATP synthase enzyme to phosphorylate ADPs to ATPs.  

Learn More:

For more on photosynthesis check out;

brainly.com/question/12131960

#LearnWithBrainly

3 0
3 years ago
Other questions:
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • WHAT IS XYLEM AND WHAT FUNCTION DOES IT CARRY OUT IN PLANTS?
    11·1 answer
  • You are cleaning your room, when all of a sudden the smoke alarm goes off. You go into the kitchen and it is very smoky, so you
    13·1 answer
  • What causes mutations?
    10·2 answers
  • The Pacific Ocean has many deep-water trenchs. This allows the process of
    9·1 answer
  • In order to change C to B to A, one would need to:
    10·1 answer
  • 1: Plants do not have a digestive system like us. Why do they not need a
    14·1 answer
  • Cells are the basic structural, functional and biological unit of all known living organisms. Identify
    14·1 answer
  • What is the species name for humans?<br> A. Homo<br> B. Erectus<br> C. Carolus<br> D. Sapiens
    10·1 answer
  • Every time you remember something, you remember it a bit differently, and
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!