1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]2 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
Which line serves as the boundary line between one day and the next?
Klio2033 [76]
Is there any multiple choice answers <span />
3 0
3 years ago
if the contents of a cell have a solute concentration of 0.04 percent which of these solutions would cause it to swell? 10% or 1
slamgirl [31]
"0.01 percent solute concentration" is the solution among the choices given in the question that <span>would cause it to swell.</span>
8 0
3 years ago
Read 2 more answers
Corn develops from a seedling with a single cotyledon, displays parallel veins on its leaves, and produces monosulcate pollen. I
Rzqust [24]

Answer:

a monocot

Explanation:

Monocotiledoneas are plants that develop from a seedling with a single cotyledon. That is why we can say that maize is a monocotyledon.

Monocotyledons and dicotyledons are two classes of vegetables that belong to the angiosperm plants (plants with seeds contained within the fruits) and also phanerogams (flowering plants), currently classified as magnoliophytes, gathering approximately 230 thousand species. Monocotyledons are plants that have only one cotyledon in the seed. Cotyledons are the initial leaves of plant embryos.

7 0
3 years ago
1.This method of reforestation is done by natural means with the aid of the wind,birds,rodents and running water which scatters
ANEK [815]

Answer:

  1. T. Natural Reseeding.
  2. D. Species Diversity
  3. A. Ecosystem Diversity.

Explanation:

Natural reseeding uses natural elements and actors to plant the seeds of trees. These elements and actors include water, wind, birds, rodents and other actors capable of scattering seed.

Species diversity is what defines the differentiation between the different species in an ecosystem and Ecosystem diversity relates to how biological communities/ ecosystems can be different from each other based on the organisms and food chains available in each.

8 0
3 years ago
The gene for a certain syndrome is present on a Y chromosome. A man carries the gene for this syndrome. Which of the following i
mamaluj [8]

Answer:

A - Only a Boy Can get a Y Chromosome

Explanation:

MARK AS BRAINLIST

7 0
3 years ago
Read 2 more answers
Other questions:
  • The success of altruistic behavior hinges on the ability to distinguish kin from unrelated individuals. Hamilton proposed that a
    9·1 answer
  • NEED HELP QUICK PLEASE HELP
    11·1 answer
  • When jumping into water you notice resistance. this resistance is caused by water's __________?
    5·1 answer
  • The question is in the pictures:)
    10·1 answer
  • The direction of shell coiling in the snail Lymnaea peregra results from a genetic maternal effect. An autosomal allele for a ri
    9·1 answer
  • What is Acetyl-coA and how does it help with food digestion ?
    12·1 answer
  • How is mitochondrial DNA (mtDNA) typing used in forensic science?
    13·1 answer
  • Complete the following sentence. Clarice is a dairy cow that is milked irregularly. Stress may cause her to release a hormone th
    14·1 answer
  • What domain is eubacteria found in?
    9·1 answer
  • the efficiency of aerobic metabolism is greater than that of anaerobic metabolism even though much more energy is released in ae
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!