1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
If you look at the karyotypes of person a and person b and discover that they look alike, what can you infer is the same about t
nataly862011 [7]

Answer:

They belong to the same species

Explanation:

A karyotype is an image of the chromosomes of a cell usually taken by an atomic microscope in a cell arrested in the prophase stage of mitosis –because the chromatin is well condensed.

It is difficult to discern the difference between individuals of the same species using karyotype unless in exceptions of chromosomal disorders like Klinefelter's syndrome and Turners syndrome, and etcetera.

However different species will most likely differ in the number of chromosomes, the chromosomal sizes and their arms lengths.

5 0
4 years ago
The presence of a prosthetic implant indicates that the skeleton is definitely not prehistoric.
svetoff [14.1K]
False 23 the presence of prosthetic implant indicates that the skeleton is definitely not prehistoric True 24 a skull B c long limb bones Dall of 41
6 0
4 years ago
A cell begins to produce a new type of protein. This is most likely due to an alteration of the
Zigmanuir [339]

Answer:

A cell begins to produce a new type of protein. This is most likely due to an alteration of the sequence of bases in a section of a chromosome.

Explanation:

The DNA is deoxyribonucleic acid and carry genetic info for the cell. Chromosomes are made up of genes and they determine which trait that each offspring will have

DNA controls the production of protein in the cells and is the responsible part of the chromosomes for the synthesis of them. The process of protein synthesis is known as translation. <em>An alteration in the DNA results in an alteration in the mRNA because it decides the kind of protein will be synthesized in the body. With a different message, the rybosomes the protein composition will change and a new type of protein will be synthesized.</em>

4 0
3 years ago
Read 2 more answers
10. What is the relationship between air temperature and precipitation? Why?
Agata [3.3K]

Answer:

When the temperature increases there is more evaporation. When there is more evaporation the humidity increases due to more water molecules in the air. More humidity means more precipitation.

Explanation:

4 0
3 years ago
How do tortoises differ among the galapagos islands? what causes these differences?
valentinak56 [21]

Answer:

How did tortoises and birds differ among the islands of the Galapagos? The tortoises on the Galapagos Islands all had different shaped shells; therefore they were different species of the same category of tortoises. ... Darwin found several types of small, ordinary brown birds.

Hope it helps :D

Explanation:

7 0
3 years ago
Other questions:
  • Why do areas north of the Arctic Circle in the Northeren Hemisphere experience a polar day lasting for several months during the
    9·1 answer
  • Use your periodic table of elements. Take any element of your choosing (from period 4 or above) and answer the following questio
    8·1 answer
  • Which type of selection leads to increased phenotypic in genetic variation
    14·2 answers
  • How can an allopolyploid plant become a biologically fit new species?
    7·1 answer
  • How does a leaf protect itself from unwanted intruders like bacteria from getting in and stopping important reactants from going
    11·1 answer
  • What is the function of endocrine glands? a) they are the targets of hormones b) they release hormones into the bloodstream for
    7·2 answers
  • Genetic diversity is the variation in the genes of an entire species. Each circle represents a population of a particular specie
    11·2 answers
  • Which type of experiment involves changing only one variable at a time
    8·2 answers
  • CAN SOMEONE PLEASE HELP ME WITH THIS PLEASE I WANT TO PASS!!!
    7·2 answers
  • Which of the following describes a scientific use of models in environmental science?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!