1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
Do plants need to eat?Or do they acquire energy through a method different from animals?Write down the differences on how a tree
deff fn [24]
For the first half of your question, plants do need to eat. In fact, they are autotrophs, which means they are self feeders.
6 0
3 years ago
Most eukaryotic mRNAs are shorter than the genes that encode them. The reason for this is __________.
Naily [24]
I remember its B !!!!
8 0
3 years ago
Similarities and differences between RNA and DNA?
Lilit [14]
DNA and RNA both contain a cyclic nitrogenous base, a posphate group and a five-carbon sugar.  These are the base units of nucleotides which make up nucleic acids.  DNA contains the nitrogenous bases; adenine, thymine, cytosine and guanine wheresas RNA contains the bases; adenine, thymine, cytosine and urasil.  DNA codes for the nucleotides in an RNA molecule, whereas DNA codes for the amino acid sequence in a protein 
3 0
3 years ago
PLEASE HELP
Rom4ik [11]

Answer:anser is b have a good one

Explanation:

3 0
4 years ago
what is the difference between sun rays that strike at the equator and the sun rays that strike at the poles
nikklg [1K]
The sun rays that hit the equator are hotter because the equator is pointed more to the sun
Rays that strike the poles arent that effective because of the earths tilt, and it's rotating and revolving constantly
5 0
3 years ago
Other questions:
  • Hawaii has not recorded any bullfrog sightings. What policies or laws could you keep in place to prevent the bullfrog from invad
    15·1 answer
  • Alligators have internal and external development, which class might they belong to? A. Amphibia B. Reptilia C. Osteichthyes D.
    6·1 answer
  • This pea pod or fruit develops after _____ takes place during reproduction in a flowering plant
    15·2 answers
  • as an aspiring nurse,the need for the culture of a new pathogenic microorganism in the laboratory has been allocated to you. App
    15·1 answer
  • Ribosomal RNA is produced by _____. lysosomes nucleoli mitochondria Golgi bodies
    14·2 answers
  • A woman with a history of chronic alcohol abuse is admitted to the obstetric unit in labor. When assessing the newborn, which of
    12·1 answer
  • What term describes the normal genes that are inserted into an individual's diseased cells in gene therapy? Describe three ways
    15·1 answer
  • ____ carrier moves solute through a membrane up its concentration gradient, uses ATP molecule.
    9·2 answers
  • Why are NADH and FADH2 necessities in the electron transport chain?(1 point)
    5·1 answer
  • TRUE or FALSE. Write T on the blank if the statement about Causes of Extinction is correct and write F if the statement is incor
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!