1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
The fact that there appears to be a genetic component to inflammatory bowel disease, but that it does not show clear Mendelian i
Vesnalui [34]

Answer:

Option D

Explanation:

(the gene for the disease has incomplete penetrance. the gene for the disease has limited expressivity. the disease is polygenic) - all these are examples of non-mendelian inheritance which include incomplete penetrance, polygenic inheritance etc. These do not follow the mendelian pattern of inheritance.

(the gene for the disease is recessive.)- this shows the mendelian pattern of inheritance... Dominant and recessive characteristics are examples that show Mendelian inheritance.

5 0
4 years ago
There are 5 sacral vertebrae that are fused into ____________ sacrum.
Mariulka [41]
Is there any optional answers?
3 0
4 years ago
Match the terms to their definition
snow_tiger [21]

Answer:

the number of individual organisms born into a population in a given year  - Birth rate

the movement of individuals out of a population  - Emigration

the number of individual organisms that die in a population in a given year  - Death rate

the movement of individuals into a population  - Immigration

Explanation:

The birth rate describes the frequency of live births in a population. In contrast, the death rate, also called the mortality rate is the number of deaths in a population. They are usually reported as a number per 1000 people, per year.

Migration is the movement of organisms. Immigration is used to describe the act of organisms in a population into a new destination. Emigration is the act of organisms leaving their current population

3 0
3 years ago
SELLA TRUCICA is a process on A. frontal bone B. parietal bones C. temporal bones D. occipital bone E. sphenoid bone F. ethmoid
pashok25 [27]

Answer:

E. Sphenoid bone

Explanation:

Please mark me brainliest

8 0
2 years ago
Mendel crossed yellow-seeded and green-seeded pea plants and then allowed the offspring to self-pollinate to produce an F2 gener
pashok25 [27]

Answer:

C. The green allele is recessive to the yellow allele

Explanation:

Complete dominance occurs when one gene variant or allele referred to as the 'dominant allele' completely masks the expression of another allele referred to as the 'recessive allele' in heterozygous individuals, i.e., in individuals carrying one copy of the dominant allele and one copy of the recessive allele for a particular locus/gene (whereas homo-zygous individuals carry the same alleles for a given locus/gene). Mendel crossed pure lines of pea plants, i.e., homo-zygous lines for different traits such as seed color (yellow and green) and seed shape (round and wrinkled). In this case, the parental cross was YY x yy, where the 'Y' allele is dominant and encodes for yellow seed color, and the 'y' allele is recessive and encodes for green seed color. From this cross, Mendel obtained a hybrid F1 (i.e., all progeny was heterozygous with genotype Yy). An expected 3:1 ratio as observed in this case (6,022 yellow and 2,001 green seed >> 3:1 ratio) is characteristic of the progeny that results from mating between F1 heterozygous parents, where each parent has one dominant allele and one recessive allele, i.e., F1 parental cross: Yy x Yy >> F2: 1/4 YY (yellow color); 1/2 Yy (yellow color); 1/4 (green color) >> 3:1 ratio of yellow to green seeds.

4 0
3 years ago
Other questions:
  • How does a waxy cuticle prevent plant infection?
    9·1 answer
  • 35
    12·1 answer
  • As our global population rises; so does our appetite for protein. Our meat consumption habits take a serious toll on the environ
    6·1 answer
  • Can someone please help me with this problem and explain? (10 POINTS)
    12·1 answer
  • A tapeworm attaches to the wall of its host’s intestine and starts to absorb the host’s nutrients. Eventually this can cause gre
    6·1 answer
  • A ___________ stimulates the body's own immune response against invading microbes.
    14·1 answer
  • PLS ANSWER FAST WILL GIVE BRAINLY!!!!!!
    10·1 answer
  • If two organisms share the same Order, what other taxa do they share?
    5·1 answer
  • True or False?? the pressure of a gas always increases with increasing temperature
    9·1 answer
  • The separation of the colors occurs because each different ____ of light ______, or bends a different amount
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!