1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]2 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
what condition is a major contributor to disability and placement in nursing homes for those over age 75 and is often accompanie
Rina8888 [55]

Answer:

Dementia

Explanation:

Dementia is a condition that involves impaired mental ability and memory which is common among older adults. This condition, which is a major contributor to disability and placement of older adults in nursing homes, can be as a result of several factors of which nutrition has a major role to play. Metabolic and endocrine problem that results to the inability of the body system to regulate nutrients such as calcium and vitamin B-12, are some of the factors that triggers dementia in older adults. Also, nutritional deficiencies such as dehydration, inadequate intake of vitamin B-1, vitamins B-6, copper,vitamin E, and vitamin B-12 increases the chances of developing dementia in older adults.

Research shows that low levels of vitamin D can be linked to increased risk of developing dementia, and as such, supplements such as B-complex vitamin, vitamin C, and vitamin D is usually recommended for the prevention of dementia, especially when they are deficient in the diets taken.

7 0
3 years ago
Help please
photoshop1234 [79]
The answer is C because the independent variable is what you change in the experiment and you are changing the concentration of sugar
8 0
2 years ago
Read 2 more answers
Compare the properties of the parent and daughter cells in mitosis and meiosis and explain the reason for any differences.
katrin [286]
Mitosis - 48 chromosomes (diploid cells)
Meiosis - 24 chromosomes (haploid cells)

Diploid cells. Meiosis is the process of cell division by which involving gametes. Cell division is just the same for sperm and egg cells, but they have distinguishable descriptions and labels in the process. Spermatogenesis is for the males’ sperm cells and oogenesis is the process for females’ egg cells. The cell division of meiosis involves the two phases, respectively meiosis I and meiosis II. Meiosis I like mitosis is the cell division that produces diploid cells<span>. These diploid cells are cells that contain a complete pair of chromosomes which is 46. The result is two diploid cells after the first meiosis. To provide clear explanation, in contrast haploid cells only contain 23 chromosomes and are created after meiosis II which is 4 in number.</span>
7 0
2 years ago
Circulation to and from the lungs is referred to as
horsena [70]

Answer:

pulmonary circulation

Explanation:

The pulmonary circulation moves the blood between the lungs and heart. Since the blood carries oxygen the heart pumps it to every body part including the lungs so we can maintain homeostasis.

8 0
3 years ago
What is the primary function of chloroplasts? regulation of gas movement between the leaf and the environment carrying out photo
Nana76 [90]
The primary function of chloroplast is to carry out photosynthesis with the help of chlorophyll.
6 0
3 years ago
Other questions:
  • The basic unit into which the lithosphere is broken is a plate. batholith. metamorphism zone. tablet. pangaea
    8·1 answer
  • The distance between two adjacent crests of a transverse wave?
    6·1 answer
  • Can someone check this :-)
    15·2 answers
  • During the dissection, you used your hands to follow the digestive tract anteriorly and posteriorly. Outline the path that food
    5·1 answer
  • The application of genomics to evaluate the effectiveness and safety of drugs on the basis of information from an individual’s
    5·1 answer
  • Gigantic mammals (mammoths, giant sloths, etc.) characterize these times.
    12·1 answer
  • A hormone attaches to a target cell at a receptor protein. What do you know about this hormone?
    6·1 answer
  • The nurse is developing an educational program about prostate cancer. the nurse should provide information about which topic?
    11·1 answer
  • PLEASE HELP In the process of mitosis, _____ new cells are formed from one<br> original cell.
    7·1 answer
  • During which phase does a cell spend the most time? And how in your worlds
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!