1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
How do genetics (genetic predisposition) and the environment work together to cause substance abuse in individuals? What is the
vampirchik [111]

Answer: The drug abuse is influenced by the environment and exerts influence on the gene expressions.

Explanation:

The genetic make up of the person is decides, which genes will be expressed and develop a trait in an individual. But this genetic expression can be influenced by the environmental factors like food, exposure to sunlight, and others. This study which relate environment with the genetic make up is called epigenetics. No person is drug addict by birth but the consumption of drug can influence the genetic make up and traits in a abuser. So here, the environment is influencing the genetic basis of a abuser.

6 0
3 years ago
A train travels 800 kilometers in 6 hours. What is the average speed of the train?
erica [24]
Answer: 133 km/h

Explanation
7 0
3 years ago
Consider how Photosynthesis and Cellular Respiration are linked. Explain how, together, the 2 processes can be described as a cy
miv72 [106K]
The products and reactants of each cycle are connected. reactants of photosynthesis (6O2 and C6H12O6) are recycled as products in cellular respiration which produces 6H2O 6CO2 and energy to fuel photosynthesis
7 0
3 years ago
What classifies genetic mutation
lawyer [7]
I think it's nucleic acid.
7 0
3 years ago
Link the digestive and the breathing system to respiration and how the products of aerobic respiration and anaerobic respiration
UNO [17]
When food is digested, the food is broken down into Glucose, which can get into the bloodstream through the small intestines. It travels around the body in the bloods plasma and is then diffused into the body's cells through the capillaries. Once the Glucose is in the body cells, it can be used for respiration.
The breathing system is used in respiration because we need it to respire aerobically, so that our body gets all the vital oxygen it needs. When we breathe, oxygen is stored in the alveoli in the lungs. From there, it can be diffused into the bloodstream, to be used for respiration.

The products of aerobic respiration is Carbon Dioxide and Water. The Water leaves the body as sweat or waste such as urine. The Carbon Dioxide is carried through the blood to our lungs where we can breathe it out. Where as in anaerobic respiration, the product is Lactic Acid. This ends up being broken by oxygen after exercise (oxygen debt) and is also turned into Carbon Dioxide and Water.  
5 0
3 years ago
Other questions:
  • What is the function of the reproductive system
    9·1 answer
  • What do euglenoids lack? cell walls chloroplasts contractile vacuoles eyespots
    8·1 answer
  • Gamets are produced from​
    15·1 answer
  • Which of the following is true
    15·1 answer
  • ​Heartbeat, digestion, respiration, and elimination of wastes are carried out by organ systems close to the central axis. These
    14·1 answer
  • How is Pluto more like Quaoar and Sedna than it is like Neptune ?
    5·2 answers
  • a _____ time scales divides earths history into divisions that are based on major changes in geology, climate, and the evolution
    15·1 answer
  • In a biological reaction involving an enzyme, what does the substrate bind to? the active site of another substrate the inactive
    14·2 answers
  • Type II survivorship curves Your answer: are characteristic of humans and elephants. typify a population in which all ages have
    6·1 answer
  • Impaired muscular function in multiple sclerosis occurs due to frequent loss of nerve signals, one reason for loss of nerve impu
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!