1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
A certain sea slug, Elysia chlorotica, "steals" chloroplasts from algae it normally feeds upon, and then uses the chloroplasts t
FrozenT [24]

Answer:

Horizontal gene transfer

Explanation:

Horizontal gene transfer or lateral gene transfer is when an organisms of different species can acquire a gene from a different one. This process is well understood in bacteria and is responsible for the appearence of antibiotic resistant bacteria. Bacteria can take DNA fragments through a process known as transformation, but this is less common in eukaryotes. Gene transfer agents like viruses could carry the gene from one specimen to the other. Another way could be Horizontal transposon transfer but the exact mechanisms behind it are still under research.

7 0
3 years ago
Which component is released from the active site of an enzyme during a chemical reaction?
nalin [4]
Product
I hope this helps.
7 0
3 years ago
Where are the three seismographs used to find the epicenter of this earthquake located?
8090 [49]

Scientists use triangulation to find the epicenter of an earthquake. When seismic data is collected from at least three different locations, it can be used to determine the epicenter by where it intersects. Every earthquake is recorded on numerous seismographs located in different directions. Each seismograph records the times when the first (P waves) and second (S waves) seismic waves arrive. From that information, scientists can determine how fast the waves are traveling. Knowing this helps them calculate the distance from the epicenter to each seismograph.

To determine the direction each wave traveled, scientists draw circles around the seismograph locations. The radius of each circle equals the known distance to the epicenter. Where these three circles intersect is the epicenter.


7 0
3 years ago
Read 2 more answers
What are characteristics presented in all living organisms
Anna11 [10]

Answer:

Properties of Life. All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing. When viewed together, these characteristics serve to define life.

Very glad I could help!!

7 0
3 years ago
In an experiment, it was found that newborn rats who were genetically predisposed to be skittish, nervous, and high-strung would
Pepsi [2]

Answer:

a) epigenetic change.

Explanation:

Epigenetic is referred to changes BESIDES the changes in the genetic changes. It means, not related to mutations but to chemical changes such as methylation, acetylation, ubiquitylation, phosphorylation, that can interfere with the genetic expression. Chromatin modification is another way of epigenetic change.

8 0
3 years ago
Other questions:
  • Which two important things do many economics systems not considered to have value?
    5·2 answers
  • Which statement about inheritance is true? Girls get most of their traits from their moms; boys get most of their traits from th
    14·2 answers
  • Which of the following is an example of a scientific paradigm? A) Neo Darwinism, in ecology and evolution B) Survival of the Fit
    10·2 answers
  • The points of muscle attachment are known as the
    6·1 answer
  • Which is a difference between proteins and carbohydrates and fats? Proteins are macromolecules; carbohydrates and fats are not.
    10·2 answers
  • 7th grade helpppppppppp
    13·1 answer
  • The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What i
    12·1 answer
  • The figure above shows bands of DNA that were separated during gel electrophoresis.
    12·1 answer
  • As you walk down the hall on the way to class, several students sneeze. You unknowingly inhale some of the droplets
    13·1 answer
  • Name a biotic factor in the room you are in right now?<br><br> I am in my bed room and 20 points
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!