1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
What protects the stomach from acidic gastric juices
mihalych1998 [28]

This might help,the presence of hydrochloric acid creates an acidic environment within the stomach that is needed to convert pepsinogen to pepsin. Mucus that is produced by the epithelial cells of the stomach help protect the lining of the stomach from the corrosive hydrochloric acid and pepsin.

6 0
3 years ago
Read 2 more answers
Glycolysis is the first step of cellular respiration, in which glucose is used to generate ATP to power the cell. The major chem
lutik1710 [3]

Answer:

The correct answer is b. C6H12O6 -> 2 C3H4O3+2 H+

Explanation:

Glycolysis occurs in both the condition aerobic and anaerobic so it does not require oxygen. In glycolysis, one glucose molecule is converted into two pyruvate( 2 C3H4O3) and two 2 ATP, 2NADH, and 2 H₂O are produced.

Initially, 2NAD⁺ is produced during glycolysis which is reduced to produce 2NADH and 2 H⁺. Therefore the correct equation is  C6H12O6 -> 2 C3H4O3+2 H+.

Then this pyruvate is used in the Kreb cycle which is required for the complete breakdown of glucose into carbon dioxide and water and this process occurs in aerobic conditions. Complete oxidation is important to produce more energy from partially oxidized glucose.

6 0
3 years ago
Im crying because im so in a hurry help me fastas you can in this science question.
eimsori [14]
Energy convention: Convection is the motion of a fluid driven by temperature differences across that fluid. When a fluid is heated, the region in closest contact with the heat source becomes less dense due to increased kinetic energy in the particles. Convection is one of the fundamental ways that heat is transferred
3 0
3 years ago
Which phrase is not true about strong acids?
zepelin [54]
C. because there is a property of acids which stat that they turn litmus papers red instead of blue.
6 0
4 years ago
Identify the domains. Check all that apply.
alina1380 [7]

Answer:

Eukaryota, Archaea, Bacteria

Explanation:

They are the largest taxonomic groups.

4 0
4 years ago
Other questions:
  • Which of these is most likely to cause increasing numbers of severe weather events
    7·2 answers
  • Species that are_______species can occur in the same location and are phenotypically different.
    6·1 answer
  • An example of a biological event that follows a circadian rhythm is:
    13·1 answer
  • How did Darwin and Lamarck differ in their thinking about change in species​
    7·1 answer
  • Which is regulated as a result of dam building? A. fish mortality B. flooding C. shoreline erosion D. plant and animal life
    5·2 answers
  • Help!!!!!!!!!!!!!!!!!!!!!!!!!
    8·1 answer
  • The picture below represents an oxygen atom.<br> How many protons does this<br> atom<br> have?
    7·1 answer
  • What happens when the number of organisms in an environment is higher
    13·1 answer
  • Why will these changes make it more difficult for the plants to grow
    10·2 answers
  • Which type of forest contains several kinds of cone-bearing trees and typically receives a lot of snow in winter? coniferous tro
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!