1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]2 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
it important to know a person's rhesus factor before a blood transfusion? A patient who is Rh+ can receive only Rh– blood. A pat
timofeeve [1]

The right answer is A patient who is Rh– can receive only Rh– blood.

The blood group is not the only thing that matters, it adds a category: rhesus. Rhesus refers to a red blood cell antigen that is on their wall. There are two blood group systems: Rh positive (Rh +) and Rh negative (Rh-).

Rhesus is positive in people who have this antigen. It concerns the majority of the population. Negative rhesus refers to people without the antigen. This rhesus factor is especially useful to know if a blood transfusion is feasible between two people.

The blood transfusions can be "iso-rhesus", that is to say between Rh + and Rh- but only in one sense: Rh- can give to Rh + but Rh + can not give to Rh-. Again because of the presence of antibodies directed against the antigen in Rh- people.

4 0
3 years ago
Read 2 more answers
Which actions could be categorized in the “aerobic” section of the Venn diagram?
BARSIC [14]

Answer:

start process with gulcose

Explanation:

simple

3 0
2 years ago
What colors of light are absorbed? Which color is not absorbed?
erastovalidia [21]

Answer:

All colour except which is already present in the body.

Explanation:

The plant leaf has green colour so the plant absorb all the colour except green. The presence of green colour causes reflection of green colour so that's why we can see the green colour of the leaves. Every material or substance have a specific colour which can be seen when they absorb all light except the colour which is already present in it so we can say that that colour is not absorbed by the body which is already present in it.

7 0
3 years ago
The beginning of a true capillary is surrounded by a precapillary sphincter. The opening and closing of precapillary sphincters
gregori [183]

Answer: Local chemical conditions

Explanation: A Precapillary Sphincter is a smooth muscle that is located in circles around the capillaries.

The precapillary sphincter helps to coordinate blood flow to the into the capillaries by causing the capillaries to decrease the flow of blood to tissues that are dormant or not active.

7 0
3 years ago
Who discover the first cell
Irina18 [472]

Answer:

scientist Robert Hooke

Explanation:

Interested in learning more about the microscopic world, scientist Robert Hooke improved the design of the existing compound microscope in 1665. His microscope used three lenses and a stage light, which illuminated and enlarged the specimens.

5 0
3 years ago
Read 2 more answers
Other questions:
  • A nurse is providing discharge instructions to a client diagnosed with cirrhosis and varices. which information should the nurse
    12·1 answer
  • It is best to avoid serving cow's milk until the infant reaches the age of ________.
    10·1 answer
  • What is true about elements and compounds? A. Elements contain two or more compounds. B. Compounds contain two or more elements.
    9·1 answer
  • Which part of the government has authority to enforce the Clean Water Act?
    12·2 answers
  • Will geographical isolation be a major factor in the speciation of an organism that reproduces asexually?Why or why not?
    6·1 answer
  • If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the chromosome number of the fo
    12·1 answer
  • Which is a benefit to using transplants instead of seeds to start your Phoenix vegetable garden?
    15·1 answer
  • Help with number 6 please
    14·2 answers
  • What is chloroplast analogy ?
    9·1 answer
  • ]
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!