1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
Are streptococcus bacteria prokaryotic or eukaryotic?
STatiana [176]
All bacteria are prokaryotic!
4 0
3 years ago
Which of the following best explains the central role of carbon in the chemistry of living organisms
amid [387]
In laymen's terms it is easy for it to created bonds (covalent) with other elements; it is the backbone for most chemicals in the human body. It's also part of glucose sugar, one of the most common natural sugars that occurs especially in fruits.
7 0
3 years ago
Suppose that Louisa is cut by broken glass during a lab accident. Which is the proper place to dispose of the paper towels that
n200080 [17]

Answer:

<em>hazardous waste container</em>

Explanation:

In a lab, hazardous waste container contains all the waste which can be dangerous or infectious. Hence, it should be properly handled and disposed of. Due to the cut in the lab, the blood of Lousia might contain infectious microorganisms. Hence, after cleaning the blood with paper towels, the paper towels should be discarded in the hazardous waste container as the paper towel might contain hazardous microorganisms.

6 0
3 years ago
Developing nations currently produce about how many kcal of food per person per day
NARA [144]
Developing Nations currently produce about 2600 kcal of food per person per day. The growth in food consumption around the world has been accompanied by a significant structural changes and a shift in the diet away from the staple foods such as roots and tubers towards more livestock products and vegetable oils. 
8 0
3 years ago
To the<br> Your navel is<br> pelvis.<br><br><br> superior<br> inferior
Andreas93 [3]
The answer to your question is inferior
4 0
3 years ago
Other questions:
  • When you eat DNA does it become part of your DNA? Explain please
    11·1 answer
  • Is the following sentence true or false ? The temperature of the outer thermosphere is quite high...
    6·1 answer
  • A biome is a large group of plants and animals living together in a specific _____
    7·1 answer
  • Why is this distinction to doctors ?
    14·1 answer
  • Which element is being cycled through earth’s system in the image shown below?
    13·2 answers
  • Equation for cellular respiration?
    7·2 answers
  • Explain how the coronavirus and quarantine has affected the environment both locally, and globally. Give at least two important
    14·2 answers
  • What happens in an aphotic zone of a body of water?
    10·2 answers
  • What type of heredity is shown in the pedigree?
    6·2 answers
  • I need help on 13,14,15 please ASAP
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!