1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]3 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
Is a grasshopper a herbivore carnivore or omnivore
Natali [406]

Answer:

Grasshoppers are a herbivores because they eat plants

Explanation:

5 0
2 years ago
Read 2 more answers
There's a good evidence that a meteor hit earth about 65 million years ago which of the following events that the scientist thin
Aloiza [94]

Is this a true or false question?

5 0
3 years ago
What is evolution? ..............
natita [175]

Answer:

the process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the earth.

8 0
3 years ago
Read 2 more answers
What three phases of the cell cycle are considered interphase
Arlecino [84]
G1,G2 and synthesis
6 0
3 years ago
How are complementary strands of DNA held together?
Damm [24]

Answer:

I believe it is D

Explanation:

Complementary base pairs are held together by hydrogen bonds. Adenine and Thymine go together. Cytosine and Guanine go together.

6 0
3 years ago
Other questions:
  • Why diess a cell make proteins?
    13·2 answers
  • Summary of weathering , erosion , and deposition
    14·1 answer
  • Why is a flask wider on the bottom than on the top? allows for a more precise measurement allows for better thermal equilibrium
    12·2 answers
  • At what stage of development of all vertebrates appear to share many of the same characteristics?
    6·1 answer
  • An experiment was carried out to answer the question “Does the pH of water affect the
    14·2 answers
  • 1. In the first step in the life cycle of a star, it is called a:
    13·1 answer
  • Which mineral precipitates from oceans and forms rock salt? 1 quartz 2. fluorite 3 halite olivine​
    6·2 answers
  • Name the phase:<br>Hint: Chromosomes are moving apart.​
    12·1 answer
  • Need help answering this thanks.
    6·2 answers
  • Why Should We Add Crickets In Our School Lunches? <br> Introduction
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!