1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]2 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
Movement and balance are monitored by activity in the _______. A) cerebrum
Ivan

Movement and balance are monitored by activity in the cerebellum.

<h3>What is meant by the cerebellum?</h3>

The cerebellum, also known as the "little brain" because it resembles a miniature cerebrum, is in charge of balance, movement, and coordination. The pons and medulla, along with the midbrain, are commonly referred to as the brainstem. The brainstem receives, sends, and coordinates messages from the brain.

The cerebellum is the area of the brain in charge of coordinating voluntary movements. It is also in charge of a variety of functions, including motor skills like balance, coordination, and posture.

The cerebellum is important for maintaining balance by making postural adjustments. It modulates commands to motor neurons based on input from vestibular receptors and proprioceptors to compensate for changes in body position or muscle load.

Therefore, the correct answer is option B) cerebellum.

To learn more about the cerebellum refer to:

brainly.com/question/5318535

#SPJ4

3 0
1 year ago
What happened to the matter and the energy that were in the watermelon as it decomposed.
vitfil [10]

Answer:  A new study in the journal Biotechnology for Biofuels has found that those wasted watermelons could be turned into up to 2.5 million gallons of ethanol. It turns out that watermelon juice is a great base to make ethanol from -- it's full of sugar and yeast-friendly amino acids.

Explanation:

I hope it helps you!

5 0
3 years ago
А<br> is each step in a food chain that demonstrates the transfer of energy<br> DONE
WARRIOR [948]

Answer:

Trophic level

Explanation:

A trophic level is each step in a food chain that demonstrates the transfer of energy.

6 0
3 years ago
Jillian made a model of an animal cell. She used a round balloon to represent the cell membrane. She pushed objects like marbles
likoan [24]

Answer:b

Explanation: took the goddam test

7 0
3 years ago
Read 2 more answers
Two parents are carriers of cystic fibrosis. If they have four children, how many will probably have the disease?
professor190 [17]
Likely all of them will have it, if they are both carriers. 
7 0
3 years ago
Other questions:
  • Please help quick!!
    10·1 answer
  • Which of these terms applies best to all material in this tissue that is not cellular? which of these terms applies best to all
    9·1 answer
  • Living things start off slow but they ----,---- and eventually die
    11·1 answer
  • How does Sam prepare the deer hide so he can make things he needs from it?
    15·2 answers
  • True or false: the question “how much precipitation is needed to increase the amount of water in a lake by 2 feet?” Can be answe
    12·1 answer
  • What is meant by the following statement.<br><br>the cell membrane is semipermeable?
    13·2 answers
  • Pleasssss help <br>This is also due today
    13·1 answer
  • Histones are essentially identical in sequence/structure in all eukaryotic organisms from yeast to plants to animals. What does
    6·1 answer
  • How many waves are passing from y through n?<br> A.) about 10<br> B.) about 15<br> C.) about 20
    6·1 answer
  • HOW LACK OF CLEAN WATER AFFECTS PEOPLE’S LIVES?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!