1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]2 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
Is rice pudding a homogeneous or heterogeneous mixture?
wel
<span>Rice pudding would be an example of a heterogeneous mixture. A heterogeneous mixture means that different constituents of a mixture can be identified. Rice pudding consists of rice suspended in a cream. It is possible to identify the grains of rice and the creamy part of the mixture. A homogeneous mixture looks the same throughout--you cannot identify individual parts or ingredients. The parts of a homogeneous mixture are said to be uniformly distributed. Rainwater and air are examples of homogeneous mixtures.</span>
8 0
3 years ago
12. Researchers have spent decades and several millions of dollars studying diabetes among the Pima and Tohono O’odham tribes. W
Alina [70]

Answer:

A link between cardiometabolic risk factors and race and ethnicity have been studied. It has been found that the rates of cardiometabolic risk factors are higher among ethnic minority populations such as African Americans, Hispanic Americans, and Native Americans. 

6 0
3 years ago
Will give 100 points!! ASAP
Jobisdone [24]
Uh the answer is B. Humans
4 0
3 years ago
Why didn't darwin use mendel's results when formulating his theory of evolution by natural selection?
Naily [24]

Answer;

Mendel's work was not well known until many years after Darwin published his theory of evolution

Explanation;

-Mendel's work was ignored because it was not widely distributed, and he didn't make an effort to promote himself. In actual fact, the reasons are more complex.

-Gregor Mendel had the answer to Darwin's problem. Traits were not blended, but inherited whole. And according to Mendel's laws of inheritance, a trait that might disappear in one generation might reappear in the following generation. Modern Neo-Darwinism combines both Darwin's and Mendel's work.

3 0
3 years ago
Cognitive behavioral therapies are effective treatments for anxiety disorders. _____________ is/are a key component of this ther
Anvisha [2.4K]

Answer:

Collaborative empiricism

Explanation:

Collaborative empiricism is based on establishing a therapeutic relationship which is becomes a partnership by which the therapist and patient work together as a team to identify maladaptive cognitions and behaviour, test their validity, and make revisions to the therapy if needed.

5 0
3 years ago
Other questions:
  • Cellular respiration is the process that releases energy from food in the presense of__________
    5·1 answer
  • In the human retina: a) cone cells can detect color, but rod cells cannot. b) cone cells are more sensitive than rod cells to li
    6·1 answer
  • Which two statements are true for the cross illustrated by this Punnet square? ( Can be more than one answer)
    12·2 answers
  • Which describes the four cells that are produced at the end of meiosis? identical haploid cells genetically different diploid ce
    14·2 answers
  • The forelimbs of humans, cats, and bats have a number of detailed similarities in their construction. what best explains these s
    15·1 answer
  • what is the most important responsibility of individual in creating a safe environment especially on public health. ​
    6·1 answer
  • What is the definition of chemical reaction??? I need help
    14·2 answers
  • __________ involves providing assistance with daily living activities to an elderly relative who is chronically frail, ill, disa
    15·1 answer
  • Part A Match the structures with their appropriate functions: O Roots allow plants to obtain water, nutrients and glucose, while
    10·1 answer
  • BLOCK:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!