1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
12

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

dentify the 5' and 3' ends.)
Biology
1 answer:
Marat540 [252]2 years ago
7 0

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

You might be interested in
Neurotransmitter molecules are stored in ______________.
Over [174]

In synaptic vesicles.

4 0
3 years ago
What subatomic particles are involved in chemical bonds
scoray [572]

Answer:

Actually, the ELECTRON: Negatively charged particles in an atom. Electrons, which spin around the protons and neutrons that make up the atom's nucleus, are essential to chemical bonding.

Explanation:

3 0
3 years ago
A very large fire broke out in the Sandia Mountains. Explain how this might affect the different organisms (plant and animal) th
Svet_ta [14]
This can affect the organisms living there because now, their environment is probably different than what they have been living in for a long time, so now they have to adapt to this new environment, and if they don't, the organisms will probably end up dying.
6 0
3 years ago
Endocrine glands are responsible for
erik [133]
You are right, it is B because, endocrine glands, as part of the endocrine system, they regulate and maintain a constant equilibrium in our bodies, known as homeostasis. 
3 0
3 years ago
Read 2 more answers
Em uma equação o que significa o sinal +​
Xelga [282]
The value sign(x) equals −1, 0, or 1 depending upon whether the value x is negative, zero, or positive. Sometimes this is written as sgn(x) as is the case h


El signo de valor (x) es igual a -1, 0 o 1, dependiendo de si el valor x es negativo, cero o positivo. A veces esto se escribe como sgn (x) como es el caso h
4 0
3 years ago
Other questions:
  • What do boys like the most about girls
    14·1 answer
  • Which of the following is a nucleotide found in DNA?
    9·1 answer
  • Anatomy and physiology- biology 1 <br>any problem from 25-41
    14·1 answer
  • What describes each hydrogen bond?
    12·1 answer
  • Earth can be divided into four main systems or spheres. Which system contains Earth’s weather and forms the different climates a
    5·1 answer
  • RNA interference can be a mechanism of defense against viral infection as well as for regulation of gene expression. RNA interfe
    6·1 answer
  • Opsins are proteins that are found in the light-sensing cells in the human eye. Different opsin proteins are sensitive to differ
    7·1 answer
  • Select which of these might be a positive effect of the increase in carbon dioxide levels?
    5·1 answer
  • A community needs more electrical energy. The community is located in an
    9·2 answers
  • Which of the following planets has the largest elliptical orbit?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!