1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
velikii [3]
3 years ago
13

Lindsey pushes neil down, causing him to scrape his knee. what type of consequence does she experience when told to get a wet to

wel to help clean the cut?
Biology
1 answer:
zepelin [54]3 years ago
3 0
Punishment....................
You might be interested in
Energy flows through an ecosystem in one ____, from the sun or organic compounds to ____ and the to various ____ . ((HELP ME PLE
vlabodo [156]
Hi!

Energy will flow through an ecosystem in one <em>direction, </em>from the sun or inorganic compounds to<em> autotrophs </em>and then to various <em>heterotrophs. </em>

The energy flow in an area will be delivering light energy to <em>autotrophs</em>, which make their food from the energy the sun produces. 

The energy flow also delivers energy via inorganic compounds to <em>heterotrophs</em>, which do not make their own food.

Hopefully, this helps! =)
8 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
What second messenger most directly causes calcium ions to be released from intracellular stores?
NemiM [27]

Answer: adenylyl cyclase inositol triphosphate mainly known as IP3 causes the release of Calcium ions directly from the inracellular stores and causea contraction.

Explanation:

IP3, inositol phosphate is a second messenger a signaling molecule. It is made by hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2), a phospholipid that is located in the plasma membrane, by an enzyme phospholipase C.

IP3 binds to the calcium channels and opens Ca2+ channels that are embedded in the ER membrane, releasing Ca2+ into the cytosol. Calcium ions released may cause contraction and regulate the Ca2+ channels in the membranes.

6 0
2 years ago
If the same kind of fossil is found on two continents that are widely separated today, what does that tell us? A) The continents
Luda [366]

A The continents were once joined together

Explanation:

All the continents were once together making a huge one called Pangea.

5 0
3 years ago
Read 2 more answers
Explain why offspring of plants exposed to radiation may have characteristics not found in the original population.
iVinArrow [24]
Radiation can damage DNA. This could result in a change in the proteins which make up the plant's physical structure. 

<span>For example, a plant might have a gene for purple pigment which makes its flowers purple. Radiation might change the DNA sequence so that the directions for making the purple pigment tell it to stop prematurely, and the result might be white flowers rather than purple flowers.</span>
5 0
3 years ago
Other questions:
  • What are some problems that can occur from an altered gene that makes hemoglobin?
    13·1 answer
  • Why do you pass out if you lock your knees?
    6·1 answer
  • "why is it necessary to phosphorylate a glucose molecule, creating glucose-6-phosphate
    11·1 answer
  • What is the realationship between mutation and adoption? ⚠️! 30 points!⚠️
    9·2 answers
  • What is a Degree Heating Week?
    13·1 answer
  • What can affect the homeostasis ecosystem
    9·1 answer
  • Which of the following does NOT occur during the light independent process? A. CO2 is used to form carbohydrates B. NADPH conver
    13·2 answers
  • Choose the following that is NOT a physiological benefit of exercise. *
    5·1 answer
  • ‼️‼️Help me out pls‼️‼️
    11·1 answer
  • 18. What are the five muscles that form a box to control the wrist?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!