1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
docker41 [41]
3 years ago
9

Process of diffusion in living organisms

Biology
1 answer:
ddd [48]3 years ago
7 0
HEY MATE....!
HERE'S THE ANSWER

Diffusion is a process in which particles of two or more substances intermixed with each other.

HOPE IT HELPS....
You might be interested in
An adult inhales about 6.0×10−4 m3 of fresh air during a breath. Only 20% of fresh air is oxygen. Assume the pressure in the lun
Luda [366]

the answer is D 2.9 X10^25

3 0
3 years ago
Information about the four organisms can be found on the internet. Use credible websites to find answers to the question you dev
aliina [53]

Answer:

Explanation:

8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
This is the variable group in an amino acid this part of an amino acid is what makes it unique
Kobotan [32]

Answer:

can you give detail

Explanation:

7 0
3 years ago
Which brain region shows the most rapid growth during the first year of life?
ollegr [7]
<span>The cerebellum which is responsible for motor skills, experiences the most rapid growth during the first year of life. The cerebellum is also responsible for balance as well as muscle tone. The cerebellum is one of the most important parts of the brain.</span>
8 0
3 years ago
Other questions:
  • How does the ear work (the three different segments in the ear)
    8·1 answer
  • The antepartum nurse is caring for a patient with a family history of neural tube defects. the patient declines genetic counseli
    14·1 answer
  • Which statement about electrons and atomic orbitals is NOT true? An atom’s lowest energy level has only one orbital. An electron
    11·1 answer
  • What is the first step you can take to meet your personal health goals?
    7·1 answer
  • What is over utilisation?
    8·1 answer
  • TAKE A LOOK<br> 1. Identify What are two<br> things that are the same in<br> all nucleotides?
    14·1 answer
  • What is true concerning an ecological community?
    9·1 answer
  • How is the circulatory system related to the digestive system??
    12·1 answer
  • Use the drop-down menus to identify if each phrase describes a feature of a map, a globe, or both.
    13·1 answer
  • You stain a sample of bacteria using the Gram stain and see gram-positive rods. You then test a sample of the same bacteria usin
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!