1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nina [5.8K]
3 years ago
12

The molecule cf4 (is, is not) planar and (is, is not) polar. 1. is not; is 2. is; is not 3. is not; is not 4. is; is

Biology
1 answer:
Nookie1986 [14]3 years ago
6 0
Google it... i have no idea 
You might be interested in
Someone please help me with these I can’t understand the cystic fibrosis
neonofarm [45]
All the answers are written on the same page just in a different way look for them!
4 0
3 years ago
Highest energy potential of the 4 organic molecules found in living things
NARA [144]
The highest potential of the 4 organic molecules found in living beings are nucleic acid, proteins, carbohydrates and lipids.
4 0
3 years ago
1.
Dovator [93]
1. B
2. D
3. A
4. D
5. B
6. B
7. A
8. A
9. D
10. A

I just took this quiz and got 100%... Hope this helps!
7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What’s the relationship between time and urease activity
Strike441 [17]
Specifically, urease catalyzes the hydrolysis of urea to produce ammonia and carbamate, the carbamate produced is subsequently degraded by means of spontaneous hydrolysis to produce another molecule of ammonia and carbonic acid. [1] Urease activity tends to increase the pH of the medium in which it is due to the production of ammonia. It is produced by bacteria, fungi and several higher plants. Urease, functionally, belongs to the superfamily of amidohydrolases and phosphotriesterases. [2]
7 0
2 years ago
Other questions:
  • When a solution of cesium chloride (CsCl) is subjected to high-speed centrifugation, a stable density gradient is formed. Mesels
    11·1 answer
  • "an average human has a heart rate of 70 beats per minute. if someone's heart beats at that average rate over a 70-yr lifetime,
    10·2 answers
  • 8. What aspects of the experiment should Victor have held constant?
    9·1 answer
  • A more sustainable crop production technique that mimics nature by promoting biodiversity, providing multiple habitats for natur
    10·1 answer
  • The energy that is not transferred to the next trophic level as biomass is not lost or destroyed. It is transferred to the _____
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • You look at the cell under a microscope and see that it has 34 body chromosomes and one nucleus. Second view: Several hours late
    12·1 answer
  • One reason male peacocks spread their tail feathers is to attract a mate. How does choosing a male with a bright, full tail incr
    10·2 answers
  • What is different between two alleles of the same gene?
    11·1 answer
  • A student creates a model of a calendar to show the phases of the Moon in January.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!