1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svet-max [94.6K]
3 years ago
5

What sequence of amino acids would be coded by the following set of nucleotides?

Biology
1 answer:
juin [17]3 years ago
8 0
The answer is C as the genetic correspond with the order of the nucleotides
You might be interested in
This is a type pf behavior that animals are born with and help them to survive
emmainna [20.7K]

homeostasis, that is what i think at least

6 0
3 years ago
Centimeters per century is a measurement of _____.
denis23 [38]
The answer is A. Speed.
5 0
3 years ago
Read 2 more answers
Qué relación tiene la amilasa con el proceso evolutivo de los seres vivos que la Poseen
Anastaziya [24]

Answer:

pues existen muchas

Explanation:

para ello es una enzima hidrolasa

que tiene la funcion de catalizar

la reaccion denhidròlisis

8 0
3 years ago
Different between H2 and 2h in matter​
drek231 [11]

Answer:

H2 is molecular hydrogen.it is a molecule of hydrogen that consists of two hydrogen atoms bonded together by one single bond. 2H denotes two moles of elemental hydrogen.it should be noted that elemental hydrogen is not bonded to anything.

3 0
3 years ago
Read 2 more answers
The ____ circulation brings carbon dioxide filled blood to the lungs
Inessa [10]

Answer:

Pulmonary circulation

Explanation:

The pulmonary artery is a big artery that comes from the heart, so it splits into two main branches, and brings blood from the heart to the lungs.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which type of dating does the law of superposition represent
    9·2 answers
  • How was genetic engineering able to solve the problem of tomatoes being damaged in transit without sacrificing taste?
    10·1 answer
  • You are working on a team that is designing a new drug. In order for this drug to work, it must enter the cytoplasm of specific
    7·1 answer
  • In the carbon cycle, all animals must consume
    11·1 answer
  • The shape of the beaks of Darwin's finches and industrial melanism are often cited as examples of the process of ________ leadin
    11·1 answer
  • How many months are in 80 years
    7·3 answers
  • What are the functions of the three major forms of RNA (ribosomal RNA, messenger RNA, and transfer RNA)?
    5·1 answer
  • Identify the complementary strand of DNA with the sequence: ACC GTA TCG
    7·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Humans convert ammonia to the water soluble compound urea. True O False​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!