1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Julli [10]
3 years ago
9

Which of the following is true of all organisms belonging to the kingdom Animalia?

Biology
2 answers:
alexdok [17]3 years ago
5 0

they are heterotrophs, as they can not make or synthesize their own food.

dexar [7]3 years ago
4 0

Answer:

They are heterotrophs.

Explanation:

Kingdom animalia contains animals are multi cellular (with no cell wall like plants) , heterotrophs (obtaining their energy by consuming energy releasing food substances) and eukaryotic organism. They did not contain protists and prokaryotes. Animalia kingdom have multiple cells with mitochondria & they depends on other organism for food.

They typically reproduce Sexually, they have sensory organs, the ability to move & internal digestions.

You might be interested in
How can marine mammals survive underwater for so long?
iren2701 [21]

Answer:

Special properties of an oxygen-binding protein in the muscles of marine mammals, such as seals, whales and dolphins, are the reason these animals can hold their breath underwater for long periods of time, according to a new study. ... In fact, the amount was so high in the muscle that it almost looked black in color.

Explanation:

5 0
3 years ago
Read 2 more answers
What is one byproduct of slash-and-burn clearing of the rain forest that is harming the atmosphere?
morpeh [17]

It has been estimated that ‘slash and burn’ agriculture is used by up to 500 million people worldwide. The term describes the practice of cutting and/or burning of natural vegetation for conversion into agricultural fields. Besides the disastrous implications for forest ecosystems, the practice can impact the atmosphere in two main ways if burning is implemented. Firstly by causing air pollution from the smoke, and secondly by increasing carbon dioxide in the atmosphere, which is a greenhouse gas and a driver of climate change. Living trees also remove carbon dioxide from the atmosphere during photosynthesis, and the process of ‘slash and burn’ effectively removes their carbon capturing contributions to ameliorating climate change.

7 0
3 years ago
Read 2 more answers
For this assignment, you will develop a scientific model on a poster that illustrates the role of photosynthesis and cellular re
Ratling [72]

Answer:

I don't speak English, I only translate, I'm sorry, but you like Kunno, I know, hush, I said hush, I don't talk to Kunno fans

8 0
2 years ago
The process of genetic engineering may include either four or five steps. The diagram represents the five-step process. Which be
larisa [96]

The Answer Is A!!!!!!!!!!!

3 0
3 years ago
Read 2 more answers
calculate the quantity of electrical energy used by an electrical bulb rated 60 Walt's used for 2hours​
ivanzaharov [21]

Answer:

0.12KWH

Explanation:

Time: 2hrs

Power: 60watt

60/1000

Formula: Energy=potential/time

0.06×2= 0.12KWH

6 0
3 years ago
Other questions:
  • Zebra herds that live and move together are an example of what type of dispersion?
    10·1 answer
  • Surgical removal of the innermost layer of the artery is called
    8·1 answer
  • What was the main function of the protocells fatty acid membrane
    5·1 answer
  • Can 2 organisms from the same genus be from different phyla? Why or why not?
    5·1 answer
  • Can anybody help me plz..........
    13·1 answer
  • 5. Which of the following must an animal do to survive?
    13·1 answer
  • Plant cells perform photosynthesis,which occurs in the
    9·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • A mass of hyphae makes up the body of a fungus, which is<br> called the
    14·1 answer
  • What happens if an organism gets upset
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!