1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
10

What hormone is responsible for stimulating the breakdown of liver glycogen and its release as glucose?

Biology
1 answer:
Lostsunrise [7]3 years ago
5 0
The hormones that stimulate the breakdown of liver glycogen are epinephrine and glucagon. Epinephrine is the one that triggers the glycogen breakdown inside the muscle and also inside the liver. However, the liver is the one that is more active or responsive to the hormone called glucagon than the muscles. A glucagon is a hormone which is a polypeptide hidden by the cells of our pancreas called α cells whenever our blood-sugar is low. This hormone indicates the state of starving. 
You might be interested in
What are the mechanisms of evolution?
maw [93]

Answer:

They are: mutation, non-random mating, gene flow, finite population size (genetic drift), and natural selection.

Explanation:

i hope this helped :)

5 0
3 years ago
The information of dna is actually in the form of a code where the sequence _______ ultimately in different three letter sequenc
alexandr402 [8]
The information of dna is actually in the form of a code where the sequence Codons <span>ultimately in different three letter sequence


</span>
8 0
3 years ago
A student must complete the column on the table that list the dates of the full
Nikitich [7]

Answer:

February 25, March 27, April 25, May 24

Explanation:

I did the science moon phases for this! I would explain if it showed the graph and everything.

Good luck with it!

4 0
3 years ago
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
Which food chain best models a glow of energy in this ecosystem?
leva [86]

Answer:

B

Explanation:

Energy always flows from the sun, to the producer, to the primary consumer, to the secondary consumer, to the tertiary consumer, and so on. Algae has to come after the sun, because it's a producer.

5 0
3 years ago
Other questions:
  • Which of these best describes another plant adaptation? a a plant is the same color as a grasshopper, helping the grasshopper bl
    7·2 answers
  • Almost half the birds in the yard were brown cardinals and the rest were bright red cardinals, so Jimmy perceived them as two di
    14·1 answer
  • Which event is an example of genetic drift? An earthquake kills 90 percent of the green beetles in a population of green, black,
    5·2 answers
  • A desalination plant is set up in a bay to provide fresh, drinkable water by removing salt from ocean water and returning the re
    6·1 answer
  • Whether sugar molecules provide all the elements needed to make the four types of macromolecules.
    9·1 answer
  • One positive effect of recycling aluminium cans to manufacture new beverage containers is
    8·2 answers
  • Puestions:<br>Describe the process of cellular respiration.​
    8·1 answer
  • Which of the following statement is true about fossils? Fossils are only made from living organisms. Both living and nonliving t
    8·2 answers
  • In which way does the composition of soil, an abiotic factor, rely on living things?
    13·1 answer
  • Why the initial cost of production of GMO is high
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!