1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
15

Which of the following is not part of the role of a forester?

Biology
2 answers:
katovenus [111]3 years ago
7 0
I need more information
vaieri [72.5K]3 years ago
3 0
What are the options?
You might be interested in
Glucose provides energy for cells. Different cells have different mechanisms for glucose intake. Intestinal cells contain protei
Ahat [919]

active transport in small intestines and passive transport in blood cells

7 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
If any one can help me I would like that
dem82 [27]

Answer:

Rain makes up part of earth's water cycle

Water evaporates from streams, lakes, and oceans, then condensation and precipitation occur in the form of rain.

Explanation:

I'm pretty sure this question is implying that the answers should be directly related to the water cycle. While some of the other sentences might have some truth to them, they are too vague to be considered fact, and they're not necessarily related to the process of the water cycle.

6 0
3 years ago
Assume that in cattle a spotted coat is dominant to an even coat, short horns are dominant to long horns, and the traits for coa
kow [346]

Answer:

C. 1/4

Explanation:

Let's assume that the allele for the spotted coat is "S" and the one for the even coat is "s". The allele "L" gives short horns while the recessive allele "l" imparts long horns. The genotype of the cattle heterozygous for both traits would be SsLl. A cross between two heterozygous cattle would produce progeny in following phenotype ratio=

9 spotted coat and short horns: 3 even coat and short horns: 3 spotted coat and long horns: 1 even coat and long horns.

Therefore, the proportion of the progeny with long horns = 4/16= 1/4

8 0
3 years ago
When Jorge looks at the Moon from Earth, he sees different phases of the Moon depending on the time of the month he observes the
bulgar [2K]
The moon has different phases because it’s around different times. For example, let’s say you go outside and look at the moon at 11pm, then you go and look at it again at 12 pm, it’s going to have a different phase because it’s not at the say time.

I hope this helps! This is what I was getting from the question
6 0
3 years ago
Other questions:
  • What is the vocabulary word for a section of dna that codes for a specific protein?
    11·1 answer
  • Overuse of resources is a serious issue that will affect generations to come. Identify which practice is NOT being used, or rese
    12·2 answers
  • Most specialized cells remain in the _____ phase of the cell's life cycle
    8·2 answers
  • Can someone help me with this?
    7·1 answer
  • Nina has the flu and a high fever. Choose the terms that correctly complete the sentences.
    15·2 answers
  • Which type of feedback is most helpful during the peer-review process?
    6·2 answers
  • Describe the function of the male reproductive system.
    13·1 answer
  • What is not a cause of melanoma
    5·1 answer
  • PLEASE HELP ME ON THE TOP QUESTION ASAP!!!!!!!
    6·2 answers
  • What does a ribosome do.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!