1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
2 years ago
5

Where do plants obtain their nitrogen?

Biology
2 answers:
KiRa [710]2 years ago
6 0

Answer:

The answer is D

Explanation:

Plants rely mainly on the combined nitrogen in form of ammonia or nitrates resulting from nitrogen fixation by bacteria living symbiotically in their root nidules

slavikrds [6]2 years ago
3 0

Answer:

D plants get their nitrogen from soil bacteria

Explanation:

I hope its right :)

You might be interested in
I don’t understand how to do this
Rudik [331]

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

7 0
3 years ago
How long does it take for them to move from Position A back to Position
eimsori [14]

A. 1 year

it is because it completes one full revolution in 365 days and 6 hours and it is equals to 1 year

3 0
2 years ago
Read 2 more answers
What's the difference between plant and animal cells?
EleoNora [17]
Plant cell has chloroplasts, vacuole and cell wall...
animal cell doesn't have any of these...
8 0
3 years ago
When a rainbow appears in the sky, it is because light from the visible spectrum passed through water vapor and slowed down, cau
ohaa [14]

Answer:

False

Explanation:

4 0
3 years ago
Question 18
kolbaska11 [484]

Answer:

in the population of rabit there can be four different coat colors

6 0
3 years ago
Other questions:
  • Police are investigating a series of murders in which the suspect is leaving little to no physical evidence, such as fingerprint
    9·2 answers
  • Which of the following is not a factor influencing preventive measures used to combat the spread of disease? A. Antibiotics B. C
    14·1 answer
  • What are the difference between an observation and an inference
    15·2 answers
  • Which molecules store and transmit genetic information
    15·1 answer
  • 1. What would be the net gain of ATP from the breakdown of ten molecules of glucose under aerobic conditions?
    9·2 answers
  • What is a gene in it’s simpilist form
    6·1 answer
  • How a seashell becomes a fossil
    12·1 answer
  • How are flagella and cilia alike? A. Both help to produce energy. B. They break down substances. C. They assist with movement. D
    10·2 answers
  • Why are third parties important in a political system?
    12·1 answer
  • List and describe the 5 characteristics found in all living things; be able to identify various structures or processes as repre
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!